After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse SerpinA3c Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse SERPINA3C cDNA Clone Product Information
NCBI RefSeq:BC116724.1
RefSeq ORF Size:1254bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade A, member 3C.
Gene Synonym:1A1, spi2, Kalbp, Klkbp, MGC144822, Serpina3c
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Irving JA. et al., 2000, Genome Res. 10: 1845-64. 
  • Irving J. et al., 2002, Mol Biol Evol 19 (11): 1881-90.
  • Forsyth, S. et al., 2003, Genomics 81: 336-345. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-497.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"