Quick Order

Text Size:AAA

Mouse SerpinA3c Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse SERPINA3C cDNA Clone Product Information
NCBI RefSeq:BC116724.1
RefSeq ORF Size:1254bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade A, member 3C.
Gene Synonym:1A1, spi2, Kalbp, Klkbp, MGC144822, Serpina3c
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Irving JA. et al., 2000, Genome Res. 10: 1845-64. 
  • Irving J. et al., 2002, Mol Biol Evol 19 (11): 1881-90.
  • Forsyth, S. et al., 2003, Genomics 81: 336-345. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-497.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"