SERPINA11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50435-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SERPINA11 Reagents
CRO Services
Product recommended

All SERPINA11 Reagents
SERPINA11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SERPINA11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Gm895 cDNA ORF Clone, Mouse
SERPINA11 Background Information

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified. Mouse Serpin A11, also known as SERPINA11, is a member of the serpin family.

Full Name
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11
References
  • Irving JA. et al., 2000, Genome Res. 10: 1845-64. 
  • Irving J. et al., 2002, Mol Biol Evol 19 (11): 1881-90.
  • Forsyth, S. et al., 2003, Genomics 81: 336-345. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-497.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • SERPINA11 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SERPINA11 cDNA ORF Clone in Cloning Vector, Rat RG81027-U
    SERPINA11 cDNA ORF Clone, Rat, untagged RG81027-UT
    SERPINA11 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81027-ACG
    SERPINA11 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81027-ACGLN
    SERPINA11 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81027-ACR
    SERPINA11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81027-CF
    SERPINA11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81027-NF
    SERPINA11 cDNA ORF Clone, Rat, C-His tag RG81027-CH
    SERPINA11 cDNA ORF Clone, Rat, N-His tag RG81027-NH
    SERPINA11 cDNA ORF Clone, Rat, C-HA tag RG81027-CY
    SERPINA11 cDNA ORF Clone, Rat, N-HA tag RG81027-NY
    SERPINA11 cDNA ORF Clone, Rat, C-Myc tag RG81027-CM
    SERPINA11 cDNA ORF Clone, Rat, N-Myc tag RG81027-NM
    SERPINA11 qPCR Primer Pairs, Rat RP300991

    SERPINA11 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SERPINA11 cDNA ORF Clone in Cloning Vector, Mouse MG50435-M
    SERPINA11 cDNA ORF Clone, Mouse, untagged MG50435-UT
    SERPINA11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50435-ACG
    SERPINA11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50435-ACGLN
    SERPINA11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50435-ACR
    SERPINA11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50435-NF
    SERPINA11 cDNA ORF Clone, Mouse, C-His tag MG50435-CH
    SERPINA11 cDNA ORF Clone, Mouse, N-His tag MG50435-NH
    SERPINA11 cDNA ORF Clone, Mouse, C-HA tag MG50435-CY
    SERPINA11 cDNA ORF Clone, Mouse, N-HA tag MG50435-NY
    SERPINA11 cDNA ORF Clone, Mouse, C-Myc tag MG50435-CM
    SERPINA11 cDNA ORF Clone, Mouse, N-Myc tag MG50435-NM
    SERPINA11 qPCR Primer Pairs, Mouse MP200444
    info info
    添加购物车成功! 添加购物车失败!