SERP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51941-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SERP1 Reagents
CRO Services
Product recommended

All SERP1 Reagents
SERP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
201 bp
Description
Full length Clone DNA of Mouse stress-associated endoplasmic reticulum protein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SERP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
D3Ucla1 cDNA ORF Clone, Mouse;Ramp4 cDNA ORF Clone, Mouse
SERP1 Background Information
Full Name
stress-associated endoplasmic reticulum protein 1

SERP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SERP1 cDNA ORF Clone in Cloning Vector, Rat RG85965-U
SERP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85965-ACGLN

SERP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SERP1 cDNA ORF Clone in Cloning Vector, Mouse MG51941-G
SERP1 cDNA ORF Clone, Mouse, untagged MG51941-UT
SERP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51941-ACGLN
SERP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51941-ACG
SERP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51941-ACR
SERP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51941-CF
SERP1 cDNA ORF Clone, Mouse, C-His tag MG51941-CH
SERP1 cDNA ORF Clone, Mouse, N-His tag MG51941-NH
SERP1 cDNA ORF Clone, Mouse, C-HA tag MG51941-CY
SERP1 cDNA ORF Clone, Mouse, N-HA tag MG51941-NY
SERP1 cDNA ORF Clone, Mouse, C-Myc tag MG51941-CM
SERP1 cDNA ORF Clone, Mouse, N-Myc tag MG51941-NM
SERP1 qPCR Primer Pairs, Mouse MP201814

SERP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SERP1 cDNA ORF Clone in Cloning Vector, Human HG17033-U
SERP1 cDNA ORF Clone, Human, untagged HG17033-UT
SERP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17033-ACG
SERP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17033-ACGLN
SERP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17033-ACR
SERP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17033-CF
SERP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17033-NF
SERP1 cDNA ORF Clone, Human, C-His tag HG17033-CH
SERP1 cDNA ORF Clone, Human, N-His tag HG17033-NH
SERP1 cDNA ORF Clone, Human, C-HA tag HG17033-CY
SERP1 cDNA ORF Clone, Human, N-HA tag HG17033-NY
SERP1 cDNA ORF Clone, Human, C-Myc tag HG17033-CM
SERP1 cDNA ORF Clone, Human, N-Myc tag HG17033-NM
info info
添加购物车成功! 添加购物车失败!