SERF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52885-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SERF2 Reagents
CRO Services
Product recommended

All SERF2 Reagents
SERF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
180 bp
Description
Full length Clone DNA of Mouse small EDRK-rich factor 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SERF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
C80083 cDNA ORF Clone, Mouse;m4F5rel cDNA ORF Clone, Mouse;Msmac1l cDNA ORF Clone, Mouse
SERF2 Background Information
Full Name
small EDRK-rich factor 2

SERF2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SERF2 cDNA ORF Clone in Cloning Vector, Rat RG80928-U
SERF2 cDNA ORF Clone, Rat, untagged RG80928-UT
SERF2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80928-ACG
SERF2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80928-ACGLN
SERF2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80928-ANG
SERF2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80928-ACR
SERF2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80928-ANR
SERF2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80928-CF
SERF2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80928-NF
SERF2 cDNA ORF Clone, Rat, C-His tag RG80928-CH
SERF2 cDNA ORF Clone, Rat, N-His tag RG80928-NH
SERF2 cDNA ORF Clone, Rat, C-HA tag RG80928-CY
SERF2 cDNA ORF Clone, Rat, N-HA tag RG80928-NY
SERF2 cDNA ORF Clone, Rat, C-Myc tag RG80928-CM
SERF2 cDNA ORF Clone, Rat, N-Myc tag RG80928-NM
SERF2 qPCR Primer Pairs, Rat RP300892

SERF2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SERF2 cDNA ORF Clone in Cloning Vector, Mouse MG52885-G
SERF2 cDNA ORF Clone, Mouse, untagged MG52885-UT
SERF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52885-ACG
SERF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52885-ACGLN
SERF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52885-ANG
SERF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52885-ACR
SERF2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52885-ANR
SERF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52885-NF
SERF2 cDNA ORF Clone, Mouse, C-His tag MG52885-CH
SERF2 cDNA ORF Clone, Mouse, N-His tag MG52885-NH
SERF2 cDNA ORF Clone, Mouse, C-HA tag MG52885-CY
SERF2 cDNA ORF Clone, Mouse, N-HA tag MG52885-NY
SERF2 cDNA ORF Clone, Mouse, C-Myc tag MG52885-CM
SERF2 cDNA ORF Clone, Mouse, N-Myc tag MG52885-NM

SERF2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SERF2 cDNA ORF Clone in Cloning Vector, Human HG16766-U
SERF2 cDNA ORF Clone, Human, untagged HG16766-UT
SERF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16766-ACGLN
SERF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16766-ACG
SERF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16766-ANG
SERF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16766-ACR
SERF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16766-ANR
SERF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16766-CF
SERF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16766-NF
SERF2 cDNA ORF Clone, Human, C-His tag HG16766-CH
SERF2 cDNA ORF Clone, Human, N-His tag HG16766-NH
SERF2 cDNA ORF Clone, Human, C-HA tag HG16766-CY
SERF2 cDNA ORF Clone, Human, N-HA tag HG16766-NY
SERF2 cDNA ORF Clone, Human, C-Myc tag HG16766-CM
SERF2 cDNA ORF Clone, Human, N-Myc tag HG16766-NM
info info
添加购物车成功! 添加购物车失败!