Quick Order

Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse SEMA4A cDNA Clone Product Information
    NCBI RefSeq:NM_013658.3
    RefSeq ORF Size:2283bp
    cDNA Description:Full length Clone DNA of Mus musculus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A, transcript variant 1 with N terminal Myc tag.
    Gene Synonym:SemB, Semab, AI132332, Sema4a
    Species:Mouse
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SEMA4A qPCR primers for gene expression analysis, MP200353 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tag on other vectors
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG50330-ACG$245
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG50330-ACR$245
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagMG50330-CF$215
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagMG50330-CH$215
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagMG50330-CM$215
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagMG50330-CY$215
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone in cloning vectorMG50330-M$75
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagMG50330-NF$215
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagMG50330-NH$215
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagMG50330-NM$215
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagMG50330-NY$215
    Mouse Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmidMG50330-UT$215
     Learn more about expression Vectors
    Product nameProduct name
    Background

    Semaphorin-4A, also known as Semaphorin-B, SEMA4A, Sema B and SEMAB, is a single-pass type I  membrane protein which belongs to the semaphorin family. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. Semaphorin-4A / SEMA4A contains one Ig-like C2-type (immunoglobulin-like) domain, one PSI domain and one Sema domain. Defects in SEMA4A are the cause of retinitis pigmentosa type 35 (RP35) which leads to degeneration of retinal photoreceptor cells. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. Defects in SEMA4A are also the cause of cone-rod dystrophy type 10 (CORD10) which are inherited retinal dystrophies belonging to the group of pigmentary retinopathies. CORDs are characterized by retinal pigment deposits visible on fundus examination, predominantly in the macular region, and initial loss of cone photoreceptors followed by rod degeneration.

    Semaphorins are secreted, transmembrane, and GPI-linked proteins, defined by cysteine-rich semaphorin protein domains, that have important roles in a variety of tissues. Humans have 20 semaphorins, Drosophila has five, and two are known from DNA viruses. Semaphorins are found in nematodes and crustaceans but not in non-animals. They are grouped into eight classes on the basis of phylogenetic tree analyses and the presence of additional protein motifs. Semaphorins have been implicated in diverse developmental processes such as axon guidance during nervous system development and regulation of cell migration.

    References
  • Clark H.F., et al., 2003, Genome Res. 13: 2265-2270.
  • Ota T., et al., 2004,Nat. Genet. 36: 40-45.
  • Neufeld, G. et al., 2005, Front Biosci. 10 : 751-60.
  • Fiore,R. et al., 2005, Mol Cell Biol. 25 (6):2310-9.
  • Abid A., et al., 2006, J. Med. Genet. 43:378-381.
  • Size / Price
    Catalog: MG50330-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"