SEMA3A cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50631-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SEMA3A Reagents
CRO Services
Product recommended

All SEMA3A Reagents
SEMA3A cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2319 bp
Description
Full length Clone DNA of Mouse sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SEMA3A cDNA ORF Clone, Mouse, C-HA tag Alternative Names
coll-1 cDNA ORF Clone, Mouse;Hsema-I cDNA ORF Clone, Mouse;SEMA1 cDNA ORF Clone, Mouse;Semad cDNA ORF Clone, Mouse;SemD cDNA ORF Clone, Mouse
SEMA3A Background Information

Semaphorins are a family of secreted and cell-bound signaling molecules defined by the presence of a common 500 aa Sema domain. They are best characterized in relation to axon guidance during development of the nervous system. The functions of Semaphorins 3A (SEMA3A) are mediated primarily through binding to the Neuropilin-1 (Npn-1) and Plexin-A1 coreceptor complex. Neuropilins lack a signaling-competent cytoplasetmic domain and ensure semaphorin binding, whereas the transmembrane receptor plexin mediates the intracellular response. As the first identified vertebrate semaphorin, SEMA3A functions either as a chemorepulsive agent inhibiting axonal outgrowth, or as a chemoattractive agent stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Its overexpression is associated with schizophrenia which is seen in various human tumor cell lines, and aberrant release is associated with the progression of Alzheimer's disease

Full Name
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
References
  • Giordano,A. et al., 2003, J Neurocytol.32(4):345-352.
  • Good, P. F. et al., 2005, J. Neurochem.91(3): 716-736.
  • Gu, C. et al., 2005, Science.307(5707): 265–268.
  • Chadborn,N.H. et al., 2006, J Cell Sci.119(Pt 5):951-957.
  • Schmidt,E.F. et al., 2007, Adv Exp Med Biol.600:1-11.
  • SEMA3A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SEMA3A cDNA ORF Clone in Cloning Vector, Mouse MG50631-M
    SEMA3A cDNA ORF Clone, Mouse, untagged MG50631-UT
    SEMA3A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50631-ACG
    SEMA3A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50631-ACGLN
    SEMA3A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50631-ACR
    SEMA3A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50631-CF
    SEMA3A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50631-NF
    SEMA3A cDNA ORF Clone, Mouse, C-His tag MG50631-CH
    SEMA3A cDNA ORF Clone, Mouse, N-His tag MG50631-NH
    SEMA3A cDNA ORF Clone, Mouse, N-HA tag MG50631-NY
    SEMA3A cDNA ORF Clone, Mouse, C-Myc tag MG50631-CM
    SEMA3A cDNA ORF Clone, Mouse, N-Myc tag MG50631-NM
    SEMA3A qPCR Primer Pairs, Mouse MP200613

    SEMA3A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SEMA3A cDNA ORF Clone in Cloning Vector, Human HG10758-M
    SEMA3A cDNA ORF Clone, Human, untagged HG10758-UT
    SEMA3A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10758-ACGLN
    SEMA3A cDNA ORF Clone, Human, C-GFPSpark® tag HG10758-ACG
    SEMA3A cDNA ORF Clone, Human, C-OFPSpark® tag HG10758-ACR
    SEMA3A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10758-CF
    SEMA3A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10758-NF
    SEMA3A cDNA ORF Clone, Human, C-His tag HG10758-CH
    SEMA3A cDNA ORF Clone, Human, N-His tag HG10758-NH
    SEMA3A cDNA ORF Clone, Human, C-HA tag HG10758-CY
    SEMA3A cDNA ORF Clone, Human, N-HA tag HG10758-NY
    SEMA3A cDNA ORF Clone, Human, C-Myc tag HG10758-CM
    SEMA3A cDNA ORF Clone, Human, N-Myc tag HG10758-NM
    SEMA3A qPCR Primer Pairs, Human HP100900
    info info
    添加购物车成功! 添加购物车失败!