SEC23B cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52971-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SEC23B Reagents
CRO Services
Product recommended

All SEC23B Reagents
SEC23B cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2304 bp
Description
Full length Clone DNA of Mouse SEC23B (S. cerevisiae) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SEC23B Background Information
Full Name
Sec23 homolog B (S. cerevisiae)

SEC23B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SEC23B cDNA ORF Clone in Cloning Vector, Rat RG8A6801-U
SEC23B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6801-ACGLN

SEC23B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SEC23B cDNA ORF Clone in Cloning Vector, Mouse MG52971-G
SEC23B cDNA ORF Clone, Mouse, untagged MG52971-UT
SEC23B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52971-ACG
SEC23B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52971-ACGLN
SEC23B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52971-ACR
SEC23B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52971-CF
SEC23B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52971-NF
SEC23B cDNA ORF Clone, Mouse, C-His tag MG52971-CH
SEC23B cDNA ORF Clone, Mouse, N-His tag MG52971-NH
SEC23B cDNA ORF Clone, Mouse, C-HA tag MG52971-CY
SEC23B cDNA ORF Clone, Mouse, N-HA tag MG52971-NY
SEC23B cDNA ORF Clone, Mouse, N-Myc tag MG52971-NM

SEC23B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SEC23B cDNA ORF Clone in Cloning Vector, Human HG16313-G
SEC23B cDNA ORF Clone, Human, untagged HG16313-UT
SEC23B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16313-ACGLN
SEC23B cDNA ORF Clone, Human, C-GFPSpark® tag HG16313-ACG
SEC23B cDNA ORF Clone, Human, C-OFPSpark® tag HG16313-ACR
SEC23B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16313-CF
SEC23B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16313-NF
SEC23B cDNA ORF Clone, Human, C-His tag HG16313-CH
SEC23B cDNA ORF Clone, Human, N-His tag HG16313-NH
SEC23B cDNA ORF Clone, Human, C-HA tag HG16313-CY
SEC23B cDNA ORF Clone, Human, N-HA tag HG16313-NY
SEC23B cDNA ORF Clone, Human, C-Myc tag HG16313-CM
SEC23B cDNA ORF Clone, Human, N-Myc tag HG16313-NM
SEC23B qPCR Primer Pairs, Human HP105067
info info
添加购物车成功! 添加购物车失败!