SDPR cDNA ORF Clone, Mouse, C-His tag

Cat: MG50603-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SDPR Reagents
CRO Services
Product recommended

All SDPR Reagents
SDPR cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1257 bp
Description
Full length Clone DNA of Mouse serum deprivation response with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SDPR Background Information

Serum deprivation-response protein, also known as Phosphatidylserine-binding protein, Cavin-2 and SDPR, is a member of the PTRF / SDPR family. SDPR is highly expressed in heart and lung, and expressed at lower levels in brain, kidney, liver, pancreas, placenta, and skeletal muscle. SDPR is a new regulator of caveolae biogenesis. SDPR is up-regulated in asyncronously growing fibroblasts following serum deprivation but not following contact inhibition and Down-regulated during synchronous cell cycle re-entry. Caveolae are plasma membrane invaginations with a characteristic flask-shaped morphology. They function in diverse cellular processes, including endocytosis. Loss of SDPR causes loss of caveolae. SDPR binds directly to PTRF and recruits PTRF to caveolar membranes. Overexpression of SDPR, unlike PTRF, induces deformation of caveolae and extensive tubulation of the plasma membrane. SDPR overexpression results in increased caveolae size and leads to the formation of caveolae-derived tubules containing Shiga toxin. SDPR is a membrane curvature inducing component of caveolae, and that STB-induced membrane tubulation is facilitated by caveolae. Pleckstrin and SDPR are phosphorylated by protein kinase C (PKC), the interaction between pleckstrin and SDPR was shown to be independent of PKC inhibition or activation. SDPR may facilitate the translocation of nonphosphorylated pleckstrin to the plasma membrane in conjunction with phosphoinositides that bind to the C-terminal PH domain.

Full Name
serum deprivation response
References
  • Li,X. et al., 2008, Cancer Sci. 99 (7):1326-33.
  • Hansen,C.G. et al., 2009, Nat Cell Biol. 11 (7):807-14.
  • Baig,A. et al., 2009, Platelets. 20 (7):446-57.
  • Nabi,IR. et al., 2009, Nat Cell Biol.11 (7):789-91.
  • SDPR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SDPR cDNA ORF Clone in Cloning Vector, Rat RG86556-U
    SDPR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86556-ACGLN

    SDPR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SDPR cDNA ORF Clone in Cloning Vector, Mouse MG50603-M
    SDPR cDNA ORF Clone, Mouse, untagged MG50603-UT
    SDPR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50603-ACGLN
    SDPR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50603-ACG
    SDPR cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50603-ANG
    SDPR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50603-ACR
    SDPR cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50603-ANR
    SDPR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50603-CF
    SDPR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50603-NF
    SDPR cDNA ORF Clone, Mouse, N-His tag MG50603-NH
    SDPR cDNA ORF Clone, Mouse, C-HA tag MG50603-CY
    SDPR cDNA ORF Clone, Mouse, N-HA tag MG50603-NY
    SDPR cDNA ORF Clone, Mouse, C-Myc tag MG50603-CM
    SDPR cDNA ORF Clone, Mouse, N-Myc tag MG50603-NM
    SDPR qPCR Primer Pairs, Mouse MP200589

    SDPR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SDPR cDNA ORF Clone in Cloning Vector, Human HG14090-G
    SDPR cDNA ORF Clone, Human, untagged HG14090-UT
    SDPR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14090-ACGLN
    SDPR cDNA ORF Clone, Human, C-GFPSpark® tag HG14090-ACG
    SDPR cDNA ORF Clone, Human, N-GFPSpark® tag HG14090-ANG
    SDPR cDNA ORF Clone, Human, C-OFPSpark® tag HG14090-ACR
    SDPR cDNA ORF Clone, Human, N-OFPSpark® tag HG14090-ANR
    SDPR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14090-CF
    SDPR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14090-NF
    SDPR cDNA ORF Clone, Human, C-His tag HG14090-CH
    SDPR cDNA ORF Clone, Human, N-His tag HG14090-NH
    SDPR cDNA ORF Clone, Human, C-HA tag HG14090-CY
    SDPR cDNA ORF Clone, Human, N-HA tag HG14090-NY
    SDPR cDNA ORF Clone, Human, C-Myc tag HG14090-CM
    SDPR cDNA ORF Clone, Human, N-Myc tag HG14090-NM
    SDPR qPCR Primer Pairs, Human HP102743
    info info
    添加购物车成功! 添加购物车失败!