SDHD cDNA ORF Clone, Mouse, untagged

Cat: MG52499-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SDHD Reagents
CRO Services
Product recommended

All SDHD Reagents
SDHD cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
480 bp
Description
Full length Clone DNA of Mouse succinate dehydrogenase complex, subunit D, integral membrane protein.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SDHD cDNA ORF Clone, Mouse, untagged Alternative Names
3110001M13Rik cDNA ORF Clone, Mouse;AVLL5809 cDNA ORF Clone, Mouse;C78570 cDNA ORF Clone, Mouse;PRO19626 cDNA ORF Clone, Mouse
SDHD Background Information
Full Name
succinate dehydrogenase complex, subunit D, integral membrane protein

SDHD cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SDHD cDNA ORF Clone in Cloning Vector, Canine DG70252-U
SDHD cDNA ORF Clone, Canine, untagged DG70252-UT
SDHD cDNA ORF Clone, Canine, C-GFPSpark® tag DG70252-ACG
SDHD Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70252-ACGLN
SDHD cDNA ORF Clone, Canine, N-GFPSpark® tag DG70252-ANG
SDHD cDNA ORF Clone, Canine, C-OFPSpark® tag DG70252-ACR
SDHD cDNA ORF Clone, Canine, N-OFPSpark® tag DG70252-ANR
SDHD cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70252-CF
SDHD cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70252-NF
SDHD cDNA ORF Clone, Canine, C-His tag DG70252-CH
SDHD cDNA ORF Clone, Canine, N-His tag DG70252-NH
SDHD cDNA ORF Clone, Canine, C-HA tag DG70252-CY
SDHD cDNA ORF Clone, Canine, N-HA tag DG70252-NY
SDHD cDNA ORF Clone, Canine, C-Myc tag DG70252-CM
SDHD cDNA ORF Clone, Canine, N-Myc tag DG70252-NM

SDHD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SDHD cDNA ORF Clone in Cloning Vector, Mouse MG52499-U
SDHD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52499-ACG
SDHD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52499-ACGLN
SDHD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52499-ANG
SDHD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52499-ACR
SDHD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52499-ANR
SDHD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52499-CF
SDHD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52499-NF
SDHD cDNA ORF Clone, Mouse, C-His tag MG52499-CH
SDHD cDNA ORF Clone, Mouse, N-His tag MG52499-NH
SDHD cDNA ORF Clone, Mouse, C-HA tag MG52499-CY
SDHD cDNA ORF Clone, Mouse, N-HA tag MG52499-NY
SDHD cDNA ORF Clone, Mouse, C-Myc tag MG52499-CM
SDHD cDNA ORF Clone, Mouse, N-Myc tag MG52499-NM
SDHD qPCR Primer Pairs, Mouse MP202372

SDHD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SDHD cDNA ORF Clone in Cloning Vector, Human HG14001-G
SDHD cDNA ORF Clone, Human, untagged HG14001-UT
SDHD cDNA ORF Clone, Human, C-GFPSpark® tag HG14001-ACG
SDHD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14001-ACGLN
SDHD cDNA ORF Clone, Human, N-GFPSpark® tag HG14001-ANG
SDHD cDNA ORF Clone, Human, C-OFPSpark® tag HG14001-ACR
SDHD cDNA ORF Clone, Human, N-OFPSpark® tag HG14001-ANR
SDHD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14001-CF
SDHD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14001-NF
SDHD cDNA ORF Clone, Human, C-His tag HG14001-CH
SDHD cDNA ORF Clone, Human, N-His tag HG14001-NH
SDHD cDNA ORF Clone, Human, C-HA tag HG14001-CY
SDHD cDNA ORF Clone, Human, N-HA tag HG14001-NY
SDHD cDNA ORF Clone, Human, C-Myc tag HG14001-CM
SDHD cDNA ORF Clone, Human, N-Myc tag HG14001-NM
SDHD qPCR Primer Pairs, Human HP102657
info info
添加购物车成功! 添加购物车失败!