SDHA cDNA ORF Clone, Mouse, C-His tag

Cat: MG52342-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SDHA Reagents
CRO Services
Product recommended

All SDHA Reagents
SDHA cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1995 bp
Description
Full length Clone DNA of Mouse succinate dehydrogenase complex, subunit A, flavoprotein (Fp) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SDHA cDNA ORF Clone, Mouse, C-His tag Alternative Names
1500032O14Rik cDNA ORF Clone, Mouse;2310034D06Rik cDNA ORF Clone, Mouse;4921513A11 cDNA ORF Clone, Mouse;C81073 cDNA ORF Clone, Mouse;FP cDNA ORF Clone, Mouse;SDH2 cDNA ORF Clone, Mouse;SDHF cDNA ORF Clone, Mouse
SDHA Background Information
Full Name
succinate dehydrogenase complex, subunit A, flavoprotein (Fp)

SDHA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SDHA cDNA ORF Clone in Cloning Vector, Rat RG80939-U
SDHA cDNA ORF Clone, Rat, untagged RG80939-UT
SDHA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80939-ACGLN
SDHA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80939-ACG
SDHA cDNA ORF Clone, Rat, N-GFPSpark® tag RG80939-ANG
SDHA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80939-ACR
SDHA cDNA ORF Clone, Rat, N-OFPSpark® tag RG80939-ANR
SDHA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80939-CF
SDHA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80939-NF
SDHA cDNA ORF Clone, Rat, C-His tag RG80939-CH
SDHA cDNA ORF Clone, Rat, N-His tag RG80939-NH
SDHA cDNA ORF Clone, Rat, C-HA tag RG80939-CY
SDHA cDNA ORF Clone, Rat, N-HA tag RG80939-NY
SDHA cDNA ORF Clone, Rat, C-Myc tag RG80939-CM
SDHA cDNA ORF Clone, Rat, N-Myc tag RG80939-NM
SDHA qPCR Primer Pairs, Rat RP300903

SDHA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SDHA cDNA ORF Clone in Cloning Vector, Mouse MG52342-G
SDHA cDNA ORF Clone, Mouse, untagged MG52342-UT
SDHA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52342-ACG
SDHA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52342-ACGLN
SDHA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52342-ANG
SDHA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52342-ACR
SDHA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52342-ANR
SDHA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52342-CF
SDHA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52342-NF
SDHA cDNA ORF Clone, Mouse, N-His tag MG52342-NH
SDHA cDNA ORF Clone, Mouse, C-HA tag MG52342-CY
SDHA cDNA ORF Clone, Mouse, N-HA tag MG52342-NY
SDHA cDNA ORF Clone, Mouse, C-Myc tag MG52342-CM
SDHA cDNA ORF Clone, Mouse, N-Myc tag MG52342-NM
SDHA qPCR Primer Pairs, Mouse MP202215

SDHA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SDHA cDNA ORF Clone in Cloning Vector, Human HG14343-G
SDHA cDNA ORF Clone, Human, untagged HG14343-UT
SDHA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14343-ACGLN
SDHA cDNA ORF Clone, Human, C-GFPSpark® tag HG14343-ACG
SDHA cDNA ORF Clone, Human, N-GFPSpark® tag HG14343-ANG
SDHA cDNA ORF Clone, Human, C-OFPSpark® tag HG14343-ACR
SDHA cDNA ORF Clone, Human, N-OFPSpark® tag HG14343-ANR
SDHA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14343-CF
SDHA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14343-NF
SDHA cDNA ORF Clone, Human, C-His tag HG14343-CH
SDHA cDNA ORF Clone, Human, N-His tag HG14343-NH
SDHA cDNA ORF Clone, Human, C-HA tag HG14343-CY
SDHA cDNA ORF Clone, Human, N-HA tag HG14343-NY
SDHA cDNA ORF Clone, Human, C-Myc tag HG14343-CM
SDHA cDNA ORF Clone, Human, N-Myc tag HG14343-NM
SDHA qPCR Primer Pairs, Human HP100014
info info
添加购物车成功! 添加购物车失败!