RISC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52076-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RISC Reagents
CRO Services
Product recommended

All RISC Reagents
RISC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1359 bp
Description
Full length Clone DNA of Mouse serine carboxypeptidase 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RISC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2410018F01Rik cDNA ORF Clone, Mouse;4833411K15Rik cDNA ORF Clone, Mouse;AI957256 cDNA ORF Clone, Mouse;Risc cDNA ORF Clone, Mouse
RISC Background Information
Full Name
serine carboxypeptidase 1

RISC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RISC cDNA ORF Clone in Cloning Vector, Mouse MG52076-G
RISC cDNA ORF Clone, Mouse, untagged MG52076-UT
RISC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52076-ACGLN
RISC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52076-ACG
RISC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52076-ACR
RISC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52076-CF
RISC cDNA ORF Clone, Mouse, C-His tag MG52076-CH
RISC cDNA ORF Clone, Mouse, N-His tag MG52076-NH
RISC cDNA ORF Clone, Mouse, C-HA tag MG52076-CY
RISC cDNA ORF Clone, Mouse, N-HA tag MG52076-NY
RISC cDNA ORF Clone, Mouse, C-Myc tag MG52076-CM
RISC cDNA ORF Clone, Mouse, N-Myc tag MG52076-NM
RISC qPCR Primer Pairs, Mouse MP201949

RISC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RISC cDNA ORF Clone in Cloning Vector, Human HG13712-G
RISC cDNA ORF Clone, Human, untagged HG13712-UT
RISC cDNA ORF Clone, Human, C-GFPSpark® tag HG13712-ACG
RISC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13712-ACGLN
RISC cDNA ORF Clone, Human, C-OFPSpark® tag HG13712-ACR
RISC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13712-CF
RISC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13712-NF
RISC cDNA ORF Clone, Human, C-His tag HG13712-CH
RISC cDNA ORF Clone, Human, N-His tag HG13712-NH
RISC cDNA ORF Clone, Human, C-HA tag HG13712-CY
RISC cDNA ORF Clone, Human, N-HA tag HG13712-NY
RISC cDNA ORF Clone, Human, C-Myc tag HG13712-CM
RISC cDNA ORF Clone, Human, N-Myc tag HG13712-NM
RISC qPCR Primer Pairs, Human HP102389
info info
添加购物车成功! 添加购物车失败!