SCARB2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50052-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SCARB2 Reagents
CRO Services
Product recommended

All SCARB2 Reagents
SCARB2 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1437 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse scavenger receptor class B, member 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI (6kb + 1.48kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SCARB2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SCARB2 cDNA ORF Clone, Mouse, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
SCARB2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
9330185J12Rik cDNA ORF Clone, Mouse;Cd36l2 cDNA ORF Clone, Mouse;LGP85 cDNA ORF Clone, Mouse;LIMP-2 cDNA ORF Clone, Mouse;MLGP85 cDNA ORF Clone, Mouse
SCARB2 Background Information

Lysosomal Integral Membrane Protein II (LIMPII), also known as SCARB2, LPG85, and CD36L2, is a type I II multi-pass membrane glycoprotein that is located primarily in limiting membranes of lysosomes and endosomes on all tissues and cell types so far examined. This protein may participate in membrane transportation and the reorganization of endosomal/lysosomal compartment. LIMPII is identified as a receptor for EV71 (human enterovirus species A, Enterovirus 71) and CVA16 (coxsackievirus A16) which are most frequently associated with hand, foot and mouth disease (HFMD). Expression of human LIMPII enables normally unsusceptible cell lines to support the viruses’ propagation and develop cytopathic effects. In addition, LIMPII also has been shown to bind thrombospondin-1, may contribute to the pro-adhesive changes of activated platelets during coagulation, and inflammation. Deficiency of the protein in mice impairs cell membrane transport processes and causes pelvic junction obstruction, deafness, and peripheral neuropathy.

Full Name
scavenger receptor class B, member 2
References
  • Crombie, R. et al., 1998, J. Biol. Chem. 273: 4855-4863.
  • Febbraio, M. et al., 2001, J. Clin. Invest. 108: 785-791.
  • Kuronita, T. et al., 2002, J. Cell Sci. 115: 4117-4131.
  • Gamp, A.C. et al., 2003, Human Molecular Genetics. 12: 631-646.
  • Eskelinen, E.L. et al., 2003, Trends in Cell Biology. 13: 137-145.
  • Mulcahy, J.V. et al.,2004, Biochem. J. 377 (Pt 3): 741–747.
  • Yamayoshi, S. et al., 2009, Nat Med. 15 (7): 798-801.
  • SCARB2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SCARB2 cDNA ORF Clone, Rat, untagged RG84097-UT
    SCARB2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG84097-ACG
    SCARB2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84097-ACGLN
    SCARB2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG84097-ACR
    SCARB2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG84097-CF
    SCARB2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG84097-NF
    SCARB2 cDNA ORF Clone, Rat, C-His tag RG84097-CH
    SCARB2 cDNA ORF Clone, Rat, N-His tag RG84097-NH
    SCARB2 cDNA ORF Clone, Rat, C-HA tag RG84097-CY
    SCARB2 cDNA ORF Clone, Rat, N-HA tag RG84097-NY
    SCARB2 cDNA ORF Clone, Rat, C-Myc tag RG84097-CM
    SCARB2 cDNA ORF Clone, Rat, N-Myc tag RG84097-NM

    SCARB2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SCARB2 cDNA ORF Clone in Cloning Vector, Mouse MG50052-M
    SCARB2 cDNA ORF Clone, Mouse, untagged MG50052-UT
    SCARB2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50052-ACG
    SCARB2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50052-ACGLN
    SCARB2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50052-ACR
    SCARB2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50052-CF
    SCARB2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50052-NF
    SCARB2 cDNA ORF Clone, Mouse, C-His tag MG50052-CH
    SCARB2 cDNA ORF Clone, Mouse, N-His tag MG50052-NH
    SCARB2 cDNA ORF Clone, Mouse, N-HA tag MG50052-NY
    SCARB2 cDNA ORF Clone, Mouse, C-Myc tag MG50052-CM
    SCARB2 cDNA ORF Clone, Mouse, N-Myc tag MG50052-NM
    SCARB2 qPCR Primer Pairs, Mouse MP200052

    SCARB2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SCARB2 cDNA ORF Clone in Cloning Vector, Human HG11063-M
    SCARB2 cDNA ORF Clone, Human, untagged HG11063-UT
    SCARB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11063-ACGLN
    SCARB2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11063-ACG
    SCARB2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11063-ANG
    SCARB2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11063-ACR
    SCARB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11063-CF
    SCARB2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11063-NF
    SCARB2 cDNA ORF Clone, Human, C-His tag HG11063-CH
    SCARB2 cDNA ORF Clone, Human, N-His tag HG11063-NH
    SCARB2 cDNA ORF Clone, Human, C-HA tag HG11063-CY
    SCARB2 cDNA ORF Clone, Human, N-HA tag HG11063-NY
    SCARB2 cDNA ORF Clone, Human, C-Myc tag HG11063-CM
    SCARB2 cDNA ORF Clone, Human, N-Myc tag HG11063-NM
    SCARB2 qPCR Primer Pairs, Human HP100848
    info info
    添加购物车成功! 添加购物车失败!