SCARA5 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50517-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SCARA5 Reagents
CRO Services
Product recommended

All SCARA5 Reagents
SCARA5 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1476 bp
Description
Full length Clone DNA of Mouse scavenger receptor class A, member 5 (putative) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SCARA5 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
4932433F15Rik cDNA ORF Clone, Mouse;4933425F03Rik cDNA ORF Clone, Mouse;AV278087 cDNA ORF Clone, Mouse;Tesr cDNA ORF Clone, Mouse
SCARA5 Background Information
Full Name
scavenger receptor class A, member 5

SCARA5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SCARA5 cDNA ORF Clone in Cloning Vector, Mouse MG50517-M
SCARA5 cDNA ORF Clone, Mouse, untagged MG50517-UT
SCARA5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50517-ACGLN
SCARA5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50517-ACG
SCARA5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50517-ACR
SCARA5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50517-CF
SCARA5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50517-NF
SCARA5 cDNA ORF Clone, Mouse, C-His tag MG50517-CH
SCARA5 cDNA ORF Clone, Mouse, N-His tag MG50517-NH
SCARA5 cDNA ORF Clone, Mouse, C-HA tag MG50517-CY
SCARA5 cDNA ORF Clone, Mouse, N-HA tag MG50517-NY
SCARA5 cDNA ORF Clone, Mouse, N-Myc tag MG50517-NM
SCARA5 qPCR Primer Pairs, Mouse MP200509

SCARA5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SCARA5 cDNA ORF Clone in Cloning Vector, Human HG14153-G
SCARA5 cDNA ORF Clone, Human, untagged HG14153-UT
SCARA5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14153-ACGLN
SCARA5 cDNA ORF Clone, Human, C-GFPSpark® tag HG14153-ACG
SCARA5 cDNA ORF Clone, Human, C-OFPSpark® tag HG14153-ACR
SCARA5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14153-CF
SCARA5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14153-NF
SCARA5 cDNA ORF Clone, Human, C-His tag HG14153-CH
SCARA5 cDNA ORF Clone, Human, N-His tag HG14153-NH
SCARA5 cDNA ORF Clone, Human, C-HA tag HG14153-CY
SCARA5 cDNA ORF Clone, Human, N-HA tag HG14153-NY
SCARA5 cDNA ORF Clone, Human, C-Myc tag HG14153-CM
SCARA5 cDNA ORF Clone, Human, N-Myc tag HG14153-NM
SCARA5 qPCR Primer Pairs, Human HP102804
info info
添加购物车成功! 添加购物车失败!