Quick Order

Text Size:AAA

Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse SBDS cDNA Clone Product Information
NCBI RefSeq:AK014648.1
RefSeq ORF Size:753bp
cDNA Description:Full length Clone DNA of Mus musculus Shwachman-Bodian-Diamond syndrome homolog (human) with C terminal His tag.
Gene Synonym:SDS, CGI-97, AI836084, 4733401P19Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG51234-ACG$225
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG51234-ACR$225
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG51234-ANG$225
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG51234-ANR$225
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-Flag tagMG51234-CF$195
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-His tagMG51234-CH$195
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-Myc tagMG51234-CM$195
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-HA tagMG51234-CY$195
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-Flag tagMG51234-NF$195
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-His tagMG51234-NH$195
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-Myc tagMG51234-NM$195
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-HA tagMG51234-NY$195
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone in cloning vectorMG51234-U$75
Mouse SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmidMG51234-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: MG51234-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"