S100A15 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50226-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All S100A15 Reagents
CRO Services
Product recommended

All S100A15 Reagents
S100A15 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
327 bp
Description
Full length Clone DNA of Mouse S100 calcium binding protein A7A with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A15 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AY465109 cDNA ORF Clone, Mouse;Gm1020 cDNA ORF Clone, Mouse;S100a15 cDNA ORF Clone, Mouse;S100a15a cDNA ORF Clone, Mouse;S100a17l1 cDNA ORF Clone, Mouse;S100A7f cDNA ORF Clone, Mouse;S100A7L1 cDNA ORF Clone, Mouse
S100A15 Background Information

Koebnerisin is also known as protein S100-A7A (S100A7A), S100 calcium-binding protein A7-like 1 (S100A7L1) or S100 calcium-binding protein A15 (S100A15). Human S100A7A / S100A15 is a novel member of the S100 family of EF-hand calcium-binding proteins and was recently identified in psoriasis, where it is significantly upregulated in lesional skin. S100A7 is expressed by both normal cultured and malignant keratinocytes and malignant breast epithelial cells within ductal carcinoma in situ, suggesting an association with abnormal pathways of differentiation. S100A7 plays a role in the pathogenesis of inflammatory skin disease, as a chemotactic factor for hematopoietic cells. It also plays a role in early stages of breast tumor progression in association with the development of the invasive phenotype. The association of the 11.2 kDa S100A7A / S100A15 with psoriasis suggests that it contributes to the pathogenesis of the disease and could provide a molecular target for therapy. 

Full Name
S100 calcium binding protein A7A
References
  • Wolf R, et al. (2009) Highly homologous hS100A15 and hS100A7 proteins are distinctly expressed in normal breast tissue and breast cancer. Cancer Lett. 277 (1): 101-7.
  • Buchau AS, et al. (2007) S100A15, an antimicrobial protein of the skin: regulation by E. coli through Toll-like receptor 4. J Invest Dermatol. 127 (11): 2596-604.
  • Boeshans KM, et al. (2006) Purification, crystallization and preliminary X-ray diffraction of human S100A15. Acta Crystallogr Sect F Struct Biol Cryst Commun. 62 (5): 467-70.
  • info info
    添加购物车成功! 添加购物车失败!