Quick Order

Text Size:AAA

Mouse S100A5 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse S100A5 cDNA Clone Product Information
NCBI RefSeq:NM_011312.2
RefSeq ORF Size:282bp
cDNA Description:Full length Clone DNA of Mus musculus S100 calcium binding protein A5.
Gene Synonym:S100D9, S100a5
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

S100 protein?is a family of low molecular weight protein found in vertebrates characterized by two?EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is?100%?soluble in ammonium sulfate?at neutral?pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the?neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.?? Protein S100-A5, also known as Protein S-100D, S100 calcium-binding protein A5, S100A5 and S100D, is a member of the S100 family which contains two?EF-hand domains. S100A5 is also a novel member of the EF-hand superfamily of calcium-binding proteins that is poorly characterized at the protein level. It is expressed in very restricted regions of the adult brain. From birth onwards, S100A5 remained a neuronal-specific protein, only located in a subpopulation of neurons in the spiral ganglion.

References
  • Sch?fer,B.W. et al., 2000, J Biol Chem. 275 (39):30623-30.
  • Gebhardt, C. et al., 2006, Biochem Pharmacol. 72 (11):1622-31.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-9.
  • Lim, SY. et al., 2008, J Immunol. 181 (8): 5627-36.
  • Heibeck TH. et al., 2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Catalog: MG50427-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"