RUVBL2 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52382-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RUVBL2 Reagents
CRO Services
Product recommended

All RUVBL2 Reagents
RUVBL2 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1392 bp
Description
Full length Clone DNA of Mouse RuvB-like protein 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RUVBL2 cDNA ORF Clone, Mouse, C-His tag Alternative Names
mp47 cDNA ORF Clone, Mouse;p47 cDNA ORF Clone, Mouse
RUVBL2 Background Information
Full Name
RuvB-like AAA ATPase 2

RUVBL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RUVBL2 cDNA ORF Clone in Cloning Vector, Mouse MG52382-G
RUVBL2 cDNA ORF Clone, Mouse, untagged MG52382-UT
RUVBL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52382-ACGLN
RUVBL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52382-ACG
RUVBL2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52382-ANG
RUVBL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52382-ACR
RUVBL2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52382-ANR
RUVBL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52382-CF
RUVBL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52382-NF
RUVBL2 cDNA ORF Clone, Mouse, N-His tag MG52382-NH
RUVBL2 cDNA ORF Clone, Mouse, C-HA tag MG52382-CY
RUVBL2 cDNA ORF Clone, Mouse, N-HA tag MG52382-NY
RUVBL2 cDNA ORF Clone, Mouse, C-Myc tag MG52382-CM
RUVBL2 cDNA ORF Clone, Mouse, N-Myc tag MG52382-NM
RUVBL2 qPCR Primer Pairs, Mouse MP202255

RUVBL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RUVBL2 cDNA ORF Clone in Cloning Vector, Human HG14078-G
RUVBL2 cDNA ORF Clone, Human, untagged HG14078-UT
RUVBL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14078-ACGLN
RUVBL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14078-ACG
RUVBL2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14078-ANG
RUVBL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14078-ACR
RUVBL2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14078-ANR
RUVBL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14078-CF
RUVBL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14078-NF
RUVBL2 cDNA ORF Clone, Human, C-His tag HG14078-CH
RUVBL2 cDNA ORF Clone, Human, N-His tag HG14078-NH
RUVBL2 cDNA ORF Clone, Human, C-HA tag HG14078-CY
RUVBL2 cDNA ORF Clone, Human, N-HA tag HG14078-NY
RUVBL2 cDNA ORF Clone, Human, C-Myc tag HG14078-CM
RUVBL2 cDNA ORF Clone, Human, N-Myc tag HG14078-NM
RUVBL2 qPCR Primer Pairs, Human HP102732
info info
添加购物车成功! 添加购物车失败!