RRP8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51931-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RRP8 Reagents
CRO Services
Product recommended

All RRP8 Reagents
RRP8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1374 bp
Description
Full length Clone DNA of Mouse ribosomal RNA processing 8, methyltransferase, homolog (yeast) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RRP8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
1500003O22Rik cDNA ORF Clone, Mouse;2900001K19Rik cDNA ORF Clone, Mouse;AW538116 cDNA ORF Clone, Mouse
RRP8 Background Information
Full Name
ribosomal RNA processing 8, methyltransferase, homolog (yeast)

RRP8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RRP8 cDNA ORF Clone in Cloning Vector, Mouse MG51931-G
RRP8 cDNA ORF Clone, Mouse, untagged MG51931-UT
RRP8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51931-ACGLN
RRP8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51931-ACG
RRP8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51931-ANG
RRP8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51931-ACR
RRP8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51931-ANR
RRP8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51931-CF
RRP8 cDNA ORF Clone, Mouse, C-His tag MG51931-CH
RRP8 cDNA ORF Clone, Mouse, N-His tag MG51931-NH
RRP8 cDNA ORF Clone, Mouse, C-HA tag MG51931-CY
RRP8 cDNA ORF Clone, Mouse, N-HA tag MG51931-NY
RRP8 cDNA ORF Clone, Mouse, C-Myc tag MG51931-CM
RRP8 cDNA ORF Clone, Mouse, N-Myc tag MG51931-NM
RRP8 qPCR Primer Pairs, Mouse MP201804

RRP8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RRP8 cDNA ORF Clone in Cloning Vector, Human HG14508-G
RRP8 cDNA ORF Clone, Human, untagged HG14508-UT
RRP8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14508-ACGLN
RRP8 cDNA ORF Clone, Human, C-GFPSpark® tag HG14508-ACG
RRP8 cDNA ORF Clone, Human, N-GFPSpark® tag HG14508-ANG
RRP8 cDNA ORF Clone, Human, C-OFPSpark® tag HG14508-ACR
RRP8 cDNA ORF Clone, Human, N-OFPSpark® tag HG14508-ANR
RRP8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14508-CF
RRP8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14508-NF
RRP8 cDNA ORF Clone, Human, C-His tag HG14508-CH
RRP8 cDNA ORF Clone, Human, N-His tag HG14508-NH
RRP8 cDNA ORF Clone, Human, C-HA tag HG14508-CY
RRP8 cDNA ORF Clone, Human, N-HA tag HG14508-NY
RRP8 cDNA ORF Clone, Human, C-Myc tag HG14508-CM
RRP8 cDNA ORF Clone, Human, N-Myc tag HG14508-NM
RRP8 qPCR Primer Pairs, Human HP103155
info info
添加购物车成功! 添加购物车失败!