RRP7A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51222-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RRP7A Reagents
CRO Services
Product recommended

All RRP7A Reagents
RRP7A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
843 bp
Description
Full length Clone DNA of Mouse ribosomal RNA processing 7 homolog A (S. cerevisiae) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RRP7A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1110014J01Rik cDNA ORF Clone, Mouse;AA408146 cDNA ORF Clone, Mouse;Kheg1 cDNA ORF Clone, Mouse
RRP7A Background Information
Full Name
ribosomal RNA processing 7 homolog A

RRP7A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RRP7A cDNA ORF Clone in Cloning Vector, Mouse MG51222-U
RRP7A cDNA ORF Clone, Mouse, untagged MG51222-UT
RRP7A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51222-ACGLN
RRP7A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51222-ACG
RRP7A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51222-ANG
RRP7A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51222-ACR
RRP7A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51222-ANR
RRP7A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51222-NF
RRP7A cDNA ORF Clone, Mouse, C-His tag MG51222-CH
RRP7A cDNA ORF Clone, Mouse, N-His tag MG51222-NH
RRP7A cDNA ORF Clone, Mouse, C-HA tag MG51222-CY
RRP7A cDNA ORF Clone, Mouse, N-HA tag MG51222-NY
RRP7A cDNA ORF Clone, Mouse, C-Myc tag MG51222-CM
RRP7A cDNA ORF Clone, Mouse, N-Myc tag MG51222-NM
RRP7A qPCR Primer Pairs, Mouse MP201105

RRP7A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RRP7A cDNA ORF Clone in Cloning Vector, Human HG24479-U
RRP7A cDNA ORF Clone, Human, untagged HG24479-UT
RRP7A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG24479-ACGLN
RRP7A cDNA ORF Clone, Human, C-GFPSpark® tag HG24479-ACG
RRP7A cDNA ORF Clone, Human, N-GFPSpark® tag HG24479-ANG
RRP7A cDNA ORF Clone, Human, C-OFPSpark® tag HG24479-ACR
RRP7A cDNA ORF Clone, Human, N-OFPSpark® tag HG24479-ANR
RRP7A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG24479-CF
RRP7A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG24479-NF
RRP7A cDNA ORF Clone, Human, C-His tag HG24479-CH
RRP7A cDNA ORF Clone, Human, N-His tag HG24479-NH
RRP7A cDNA ORF Clone, Human, C-HA tag HG24479-CY
RRP7A cDNA ORF Clone, Human, N-HA tag HG24479-NY
RRP7A cDNA ORF Clone, Human, C-Myc tag HG24479-CM
RRP7A cDNA ORF Clone, Human, N-Myc tag HG24479-NM
info info
添加购物车成功! 添加购物车失败!