RPS6 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51232-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPS6 Reagents
CRO Services
Product recommended

All RPS6 Reagents
RPS6 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
750 bp
Description
Full length Clone DNA of Mouse ribosomal protein S6 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS6 cDNA ORF Clone, Mouse, C-His tag Alternative Names
S6R cDNA ORF Clone, Mouse
RPS6 Background Information
Full Name
ribosomal protein S6

RPS6 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
RPS6 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90376-G
RPS6 cDNA ORF Clone, Cynomolgus, untagged CG90376-UT
RPS6 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90376-ACGLN
RPS6 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90376-ACG
RPS6 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90376-ANG
RPS6 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90376-ACR
RPS6 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90376-ANR
RPS6 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90376-CF
RPS6 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90376-NF
RPS6 cDNA ORF Clone, Cynomolgus, C-His tag CG90376-CH
RPS6 cDNA ORF Clone, Cynomolgus, N-His tag CG90376-NH
RPS6 cDNA ORF Clone, Cynomolgus, C-HA tag CG90376-CY
RPS6 cDNA ORF Clone, Cynomolgus, N-HA tag CG90376-NY
RPS6 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90376-CM
RPS6 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90376-NM

RPS6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPS6 cDNA ORF Clone in Cloning Vector, Rat RG80730-U
RPS6 cDNA ORF Clone, Rat, untagged RG80730-UT
RPS6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80730-ACG
RPS6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80730-ACGLN
RPS6 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80730-ANG
RPS6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80730-ACR
RPS6 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80730-ANR
RPS6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80730-CF
RPS6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80730-NF
RPS6 cDNA ORF Clone, Rat, C-His tag RG80730-CH
RPS6 cDNA ORF Clone, Rat, N-His tag RG80730-NH
RPS6 cDNA ORF Clone, Rat, C-HA tag RG80730-CY
RPS6 cDNA ORF Clone, Rat, N-HA tag RG80730-NY
RPS6 cDNA ORF Clone, Rat, C-Myc tag RG80730-CM
RPS6 cDNA ORF Clone, Rat, N-Myc tag RG80730-NM
RPS6 qPCR Primer Pairs, Rat RP300694

RPS6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS6 cDNA ORF Clone in Cloning Vector, Mouse MG51232-U
RPS6 cDNA ORF Clone, Mouse, untagged MG51232-UT
RPS6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51232-ACG
RPS6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51232-ACGLN
RPS6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51232-ANG
RPS6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51232-ACR
RPS6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51232-ANR
RPS6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51232-CF
RPS6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51232-NF
RPS6 cDNA ORF Clone, Mouse, N-His tag MG51232-NH
RPS6 cDNA ORF Clone, Mouse, C-HA tag MG51232-CY
RPS6 cDNA ORF Clone, Mouse, N-HA tag MG51232-NY
RPS6 cDNA ORF Clone, Mouse, C-Myc tag MG51232-CM
RPS6 cDNA ORF Clone, Mouse, N-Myc tag MG51232-NM
RPS6 qPCR Primer Pairs, Mouse MP201115

RPS6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS6 cDNA ORF Clone in Cloning Vector, Human HG18196-U
RPS6 cDNA ORF Clone, Human, untagged HG18196-UT
RPS6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18196-ACGLN
RPS6 cDNA ORF Clone, Human, C-GFPSpark® tag HG18196-ACG
RPS6 cDNA ORF Clone, Human, N-GFPSpark® tag HG18196-ANG
RPS6 cDNA ORF Clone, Human, C-OFPSpark® tag HG18196-ACR
RPS6 cDNA ORF Clone, Human, N-OFPSpark® tag HG18196-ANR
RPS6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18196-CF
RPS6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18196-NF
RPS6 cDNA ORF Clone, Human, C-His tag HG18196-CH
RPS6 cDNA ORF Clone, Human, N-His tag HG18196-NH
RPS6 cDNA ORF Clone, Human, C-HA tag HG18196-CY
RPS6 cDNA ORF Clone, Human, N-HA tag HG18196-NY
RPS6 cDNA ORF Clone, Human, C-Myc tag HG18196-CM
RPS6 cDNA ORF Clone, Human, N-Myc tag HG18196-NM
info info
添加购物车成功! 添加购物车失败!