RPS4X cDNA ORF Clone, Mouse, C-His tag

Cat: MG52317-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPS4X Reagents
CRO Services
Product recommended

All RPS4X Reagents
RPS4X cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Mouse ribosomal protein S4, X-linked with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS4X cDNA ORF Clone, Mouse, C-His tag Alternative Names
Rps4 cDNA ORF Clone, Mouse;Rps4-1 cDNA ORF Clone, Mouse
RPS4X Background Information
Full Name
ribosomal protein S4, X-linked

RPS4X cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS4X cDNA ORF Clone in Cloning Vector, Mouse MG52317-U
RPS4X cDNA ORF Clone, Mouse, untagged MG52317-UT
RPS4X Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52317-ACGLN
RPS4X cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52317-ACG
RPS4X cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52317-ANG
RPS4X cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52317-ACR
RPS4X cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52317-ANR
RPS4X cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52317-CF
RPS4X cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52317-NF
RPS4X cDNA ORF Clone, Mouse, N-His tag MG52317-NH
RPS4X cDNA ORF Clone, Mouse, C-HA tag MG52317-CY
RPS4X cDNA ORF Clone, Mouse, N-HA tag MG52317-NY
RPS4X cDNA ORF Clone, Mouse, C-Myc tag MG52317-CM
RPS4X cDNA ORF Clone, Mouse, N-Myc tag MG52317-NM
RPS4X qPCR Primer Pairs, Mouse MP202190

RPS4X cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS4X cDNA ORF Clone in Cloning Vector, Human HG16824-U
RPS4X cDNA ORF Clone, Human, untagged HG16824-UT
RPS4X Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16824-ACGLN
RPS4X cDNA ORF Clone, Human, C-GFPSpark® tag HG16824-ACG
RPS4X cDNA ORF Clone, Human, N-GFPSpark® tag HG16824-ANG
RPS4X cDNA ORF Clone, Human, C-OFPSpark® tag HG16824-ACR
RPS4X cDNA ORF Clone, Human, N-OFPSpark® tag HG16824-ANR
RPS4X cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16824-CF
RPS4X cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16824-NF
RPS4X cDNA ORF Clone, Human, C-His tag HG16824-CH
RPS4X cDNA ORF Clone, Human, N-His tag HG16824-NH
RPS4X cDNA ORF Clone, Human, C-HA tag HG16824-CY
RPS4X cDNA ORF Clone, Human, N-HA tag HG16824-NY
RPS4X cDNA ORF Clone, Human, C-Myc tag HG16824-CM
RPS4X cDNA ORF Clone, Human, N-Myc tag HG16824-NM
info info
添加购物车成功! 添加购物车失败!