RPS2 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51282-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPS2 Reagents
CRO Services
Product recommended

All RPS2 Reagents
RPS2 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
882 bp
Description
Full length Clone DNA of Mouse ribosomal protein S2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS2 cDNA ORF Clone, Mouse, C-His tag Alternative Names
Llrep3 cDNA ORF Clone, Mouse;S4 cDNA ORF Clone, Mouse
RPS2 Background Information
Full Name
ribosomal protein S2

RPS2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS2 cDNA ORF Clone in Cloning Vector, Mouse MG51282-U
RPS2 cDNA ORF Clone, Mouse, untagged MG51282-UT
RPS2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51282-ACGLN
RPS2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51282-ACG
RPS2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51282-ANG
RPS2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51282-ACR
RPS2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51282-ANR
RPS2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51282-CF
RPS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51282-NF
RPS2 cDNA ORF Clone, Mouse, N-His tag MG51282-NH
RPS2 cDNA ORF Clone, Mouse, C-HA tag MG51282-CY
RPS2 cDNA ORF Clone, Mouse, N-HA tag MG51282-NY
RPS2 cDNA ORF Clone, Mouse, C-Myc tag MG51282-CM
RPS2 cDNA ORF Clone, Mouse, N-Myc tag MG51282-NM
RPS2 qPCR Primer Pairs, Mouse MP201164

RPS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS2 cDNA ORF Clone in Cloning Vector, Human HG16154-G
RPS2 cDNA ORF Clone, Human, untagged HG16154-UT
RPS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16154-ACGLN
RPS2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16154-ACG
RPS2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16154-ANG
RPS2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16154-ACR
RPS2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16154-ANR
RPS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16154-CF
RPS2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16154-NF
RPS2 cDNA ORF Clone, Human, C-His tag HG16154-CH
RPS2 cDNA ORF Clone, Human, N-His tag HG16154-NH
RPS2 cDNA ORF Clone, Human, C-HA tag HG16154-CY
RPS2 cDNA ORF Clone, Human, N-HA tag HG16154-NY
RPS2 cDNA ORF Clone, Human, C-Myc tag HG16154-CM
RPS2 cDNA ORF Clone, Human, N-Myc tag HG16154-NM
RPS2 qPCR Primer Pairs, Human HP104923
info info
添加购物车成功! 添加购物车失败!