RPS17 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51286-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPS17 Reagents
CRO Services
Product recommended

All RPS17 Reagents
RPS17 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
408 bp
Description
Full length Clone DNA of Mouse ribosomal protein S17 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS17 Background Information
Full Name
ribosomal protein S17

RPS17 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS17 cDNA ORF Clone in Cloning Vector, Mouse MG51286-U
RPS17 cDNA ORF Clone, Mouse, untagged MG51286-UT
RPS17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51286-ACGLN
RPS17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51286-ACG
RPS17 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51286-ANG
RPS17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51286-ACR
RPS17 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51286-ANR
RPS17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51286-CF
RPS17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51286-NF
RPS17 cDNA ORF Clone, Mouse, C-His tag MG51286-CH
RPS17 cDNA ORF Clone, Mouse, N-His tag MG51286-NH
RPS17 cDNA ORF Clone, Mouse, N-HA tag MG51286-NY
RPS17 cDNA ORF Clone, Mouse, C-Myc tag MG51286-CM
RPS17 cDNA ORF Clone, Mouse, N-Myc tag MG51286-NM
RPS17 qPCR Primer Pairs, Mouse MP201168

RPS17 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS17 cDNA ORF Clone in Cloning Vector, Human HG19802-U
RPS17 cDNA ORF Clone, Human, untagged HG19802-UT
RPS17 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19802-ACGLN
RPS17 cDNA ORF Clone, Human, C-GFPSpark® tag HG19802-ACG
RPS17 cDNA ORF Clone, Human, N-GFPSpark® tag HG19802-ANG
RPS17 cDNA ORF Clone, Human, C-OFPSpark® tag HG19802-ACR
RPS17 cDNA ORF Clone, Human, N-OFPSpark® tag HG19802-ANR
RPS17 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19802-CF
RPS17 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19802-NF
RPS17 cDNA ORF Clone, Human, C-His tag HG19802-CH
RPS17 cDNA ORF Clone, Human, N-His tag HG19802-NH
RPS17 cDNA ORF Clone, Human, C-HA tag HG19802-CY
RPS17 cDNA ORF Clone, Human, N-HA tag HG19802-NY
RPS17 cDNA ORF Clone, Human, C-Myc tag HG19802-CM
RPS17 cDNA ORF Clone, Human, N-Myc tag HG19802-NM
info info
添加购物车成功! 添加购物车失败!