RPS13 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51506-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPS13 Reagents
CRO Services
Product recommended

All RPS13 Reagents
RPS13 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
456 bp
Description
Full length Clone DNA of Mouse ribosomal protein S13 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS13 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2700063M04Rik cDNA ORF Clone, Mouse
RPS13 Background Information
Full Name
ribosomal protein S13

RPS13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS13 cDNA ORF Clone in Cloning Vector, Mouse MG51506-G
RPS13 cDNA ORF Clone, Mouse, untagged MG51506-UT
RPS13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51506-ACG
RPS13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51506-ACGLN
RPS13 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51506-ANG
RPS13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51506-ACR
RPS13 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51506-ANR
RPS13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51506-CF
RPS13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51506-NF
RPS13 cDNA ORF Clone, Mouse, C-His tag MG51506-CH
RPS13 cDNA ORF Clone, Mouse, C-HA tag MG51506-CY
RPS13 cDNA ORF Clone, Mouse, N-HA tag MG51506-NY
RPS13 cDNA ORF Clone, Mouse, C-Myc tag MG51506-CM
RPS13 cDNA ORF Clone, Mouse, N-Myc tag MG51506-NM
RPS13 qPCR Primer Pairs, Mouse MP201390

RPS13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS13 cDNA ORF Clone in Cloning Vector, Human HG20170-U
RPS13 cDNA ORF Clone, Human, untagged HG20170-UT
RPS13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20170-ACGLN
RPS13 cDNA ORF Clone, Human, C-GFPSpark® tag HG20170-ACG
RPS13 cDNA ORF Clone, Human, N-GFPSpark® tag HG20170-ANG
RPS13 cDNA ORF Clone, Human, C-OFPSpark® tag HG20170-ACR
RPS13 cDNA ORF Clone, Human, N-OFPSpark® tag HG20170-ANR
RPS13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20170-CF
RPS13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20170-NF
RPS13 cDNA ORF Clone, Human, C-His tag HG20170-CH
RPS13 cDNA ORF Clone, Human, N-His tag HG20170-NH
RPS13 cDNA ORF Clone, Human, C-HA tag HG20170-CY
RPS13 cDNA ORF Clone, Human, N-HA tag HG20170-NY
RPS13 cDNA ORF Clone, Human, C-Myc tag HG20170-CM
RPS13 cDNA ORF Clone, Human, N-Myc tag HG20170-NM
info info
添加购物车成功! 添加购物车失败!