RPS11 cDNA ORF Clone, Mouse, untagged

Cat: MG52819-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPS11 Reagents
CRO Services
Product recommended

All RPS11 Reagents
RPS11 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
477 bp
Description
Full length Clone DNA of Mouse ribosomal protein S11.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS11 Background Information
Full Name
ribosomal protein S11

RPS11 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
RPS11 cDNA ORF Clone in Cloning Vector, Canine DG70120-U

RPS11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS11 cDNA ORF Clone in Cloning Vector, Mouse MG52819-G
RPS11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52819-ACGLN
RPS11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52819-ACG
RPS11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52819-ANG
RPS11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52819-ACR
RPS11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52819-ANR
RPS11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52819-CF
RPS11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52819-NF
RPS11 cDNA ORF Clone, Mouse, C-His tag MG52819-CH
RPS11 cDNA ORF Clone, Mouse, N-His tag MG52819-NH
RPS11 cDNA ORF Clone, Mouse, C-HA tag MG52819-CY
RPS11 cDNA ORF Clone, Mouse, N-HA tag MG52819-NY
RPS11 cDNA ORF Clone, Mouse, C-Myc tag MG52819-CM
RPS11 cDNA ORF Clone, Mouse, N-Myc tag MG52819-NM

RPS11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS11 cDNA ORF Clone in Cloning Vector, Human HG16504-G
RPS11 cDNA ORF Clone, Human, untagged HG16504-UT
RPS11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16504-ACGLN
RPS11 cDNA ORF Clone, Human, C-GFPSpark® tag HG16504-ACG
RPS11 cDNA ORF Clone, Human, N-GFPSpark® tag HG16504-ANG
RPS11 cDNA ORF Clone, Human, C-OFPSpark® tag HG16504-ACR
RPS11 cDNA ORF Clone, Human, N-OFPSpark® tag HG16504-ANR
RPS11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16504-CF
RPS11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16504-NF
RPS11 cDNA ORF Clone, Human, C-His tag HG16504-CH
RPS11 cDNA ORF Clone, Human, N-His tag HG16504-NH
RPS11 cDNA ORF Clone, Human, C-HA tag HG16504-CY
RPS11 cDNA ORF Clone, Human, N-HA tag HG16504-NY
RPS11 cDNA ORF Clone, Human, C-Myc tag HG16504-CM
RPS11 cDNA ORF Clone, Human, N-Myc tag HG16504-NM
info info
添加购物车成功! 添加购物车失败!