RPL7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51225-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL7 Reagents
CRO Services
Product recommended

All RPL7 Reagents
RPL7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
813 bp
Description
Full length Clone DNA of Mouse ribosomal protein L7 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
Rpl7a cDNA ORF Clone, Mouse;Surf-3 cDNA ORF Clone, Mouse
RPL7 Background Information
Full Name
ribosomal protein L7

RPL7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPL7 cDNA ORF Clone in Cloning Vector, Rat RG85870-U
RPL7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85870-ACGLN

RPL7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL7 cDNA ORF Clone in Cloning Vector, Mouse MG51225-U
RPL7 cDNA ORF Clone, Mouse, untagged MG51225-UT
RPL7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51225-ACGLN
RPL7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51225-ACG
RPL7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51225-ANG
RPL7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51225-ACR
RPL7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51225-ANR
RPL7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51225-CF
RPL7 cDNA ORF Clone, Mouse, C-His tag MG51225-CH
RPL7 cDNA ORF Clone, Mouse, N-His tag MG51225-NH
RPL7 cDNA ORF Clone, Mouse, C-HA tag MG51225-CY
RPL7 cDNA ORF Clone, Mouse, N-HA tag MG51225-NY
RPL7 cDNA ORF Clone, Mouse, C-Myc tag MG51225-CM
RPL7 cDNA ORF Clone, Mouse, N-Myc tag MG51225-NM
RPL7 qPCR Primer Pairs, Mouse MP201108

RPL7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL7 cDNA ORF Clone in Cloning Vector, Human HG17029-U
RPL7 cDNA ORF Clone, Human, untagged HG17029-UT
RPL7 cDNA ORF Clone, Human, C-GFPSpark® tag HG17029-ACG
RPL7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17029-ACGLN
RPL7 cDNA ORF Clone, Human, N-GFPSpark® tag HG17029-ANG
RPL7 cDNA ORF Clone, Human, C-OFPSpark® tag HG17029-ACR
RPL7 cDNA ORF Clone, Human, N-OFPSpark® tag HG17029-ANR
RPL7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17029-CF
RPL7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17029-NF
RPL7 cDNA ORF Clone, Human, C-His tag HG17029-CH
RPL7 cDNA ORF Clone, Human, N-His tag HG17029-NH
RPL7 cDNA ORF Clone, Human, C-HA tag HG17029-CY
RPL7 cDNA ORF Clone, Human, N-HA tag HG17029-NY
RPL7 cDNA ORF Clone, Human, C-Myc tag HG17029-CM
RPL7 cDNA ORF Clone, Human, N-Myc tag HG17029-NM
info info
添加购物车成功! 添加购物车失败!