RPL22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52132-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL22 Reagents
CRO Services
Product recommended

All RPL22 Reagents
RPL22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
387 bp
Description
Full length Clone DNA of Mouse ribosomal protein L22 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2700038K18Rik cDNA ORF Clone, Mouse
RPL22 Background Information
Full Name
ribosomal protein L22

RPL22 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL22 cDNA ORF Clone in Cloning Vector, Mouse MG52132-U
RPL22 cDNA ORF Clone, Mouse, untagged MG52132-UT
RPL22 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52132-ACGLN
RPL22 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52132-ACG
RPL22 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52132-ANG
RPL22 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52132-ACR
RPL22 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52132-ANR
RPL22 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52132-CF
RPL22 cDNA ORF Clone, Mouse, C-His tag MG52132-CH
RPL22 cDNA ORF Clone, Mouse, N-His tag MG52132-NH
RPL22 cDNA ORF Clone, Mouse, C-HA tag MG52132-CY
RPL22 cDNA ORF Clone, Mouse, N-HA tag MG52132-NY
RPL22 cDNA ORF Clone, Mouse, C-Myc tag MG52132-CM
RPL22 cDNA ORF Clone, Mouse, N-Myc tag MG52132-NM
RPL22 qPCR Primer Pairs, Mouse MP202005

RPL22 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL22 cDNA ORF Clone in Cloning Vector, Human HG16861-U
RPL22 cDNA ORF Clone, Human, untagged HG16861-UT
RPL22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16861-ACGLN
RPL22 cDNA ORF Clone, Human, C-GFPSpark® tag HG16861-ACG
RPL22 cDNA ORF Clone, Human, N-GFPSpark® tag HG16861-ANG
RPL22 cDNA ORF Clone, Human, C-OFPSpark® tag HG16861-ACR
RPL22 cDNA ORF Clone, Human, N-OFPSpark® tag HG16861-ANR
RPL22 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16861-CF
RPL22 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16861-NF
RPL22 cDNA ORF Clone, Human, C-His tag HG16861-CH
RPL22 cDNA ORF Clone, Human, N-His tag HG16861-NH
RPL22 cDNA ORF Clone, Human, C-HA tag HG16861-CY
RPL22 cDNA ORF Clone, Human, N-HA tag HG16861-NY
RPL22 cDNA ORF Clone, Human, C-Myc tag HG16861-CM
RPL22 cDNA ORF Clone, Human, N-Myc tag HG16861-NM
info info
添加购物车成功! 添加购物车失败!