RPL18A cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51668-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL18A Reagents
CRO Services
Product recommended

All RPL18A Reagents
RPL18A cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Mouse ribosomal protein L18A with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL18A cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2510019J09Rik cDNA ORF Clone, Mouse
RPL18A Background Information
Full Name
ribosomal protein L18a

RPL18A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL18A cDNA ORF Clone in Cloning Vector, Mouse MG51668-G
RPL18A cDNA ORF Clone, Mouse, untagged MG51668-UT
RPL18A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51668-ACGLN
RPL18A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51668-ACG
RPL18A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51668-ANG
RPL18A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51668-ACR
RPL18A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51668-ANR
RPL18A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51668-CF
RPL18A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51668-NF
RPL18A cDNA ORF Clone, Mouse, C-His tag MG51668-CH
RPL18A cDNA ORF Clone, Mouse, N-His tag MG51668-NH
RPL18A cDNA ORF Clone, Mouse, C-HA tag MG51668-CY
RPL18A cDNA ORF Clone, Mouse, N-HA tag MG51668-NY
RPL18A cDNA ORF Clone, Mouse, N-Myc tag MG51668-NM
RPL18A qPCR Primer Pairs, Mouse MP201541

RPL18A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL18A cDNA ORF Clone in Cloning Vector, Human HG16398-G
RPL18A cDNA ORF Clone, Human, untagged HG16398-UT
RPL18A cDNA ORF Clone, Human, C-GFPSpark® tag HG16398-ACG
RPL18A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16398-ACGLN
RPL18A cDNA ORF Clone, Human, N-GFPSpark® tag HG16398-ANG
RPL18A cDNA ORF Clone, Human, C-OFPSpark® tag HG16398-ACR
RPL18A cDNA ORF Clone, Human, N-OFPSpark® tag HG16398-ANR
RPL18A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16398-CF
RPL18A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16398-NF
RPL18A cDNA ORF Clone, Human, C-His tag HG16398-CH
RPL18A cDNA ORF Clone, Human, N-His tag HG16398-NH
RPL18A cDNA ORF Clone, Human, C-HA tag HG16398-CY
RPL18A cDNA ORF Clone, Human, N-HA tag HG16398-NY
RPL18A cDNA ORF Clone, Human, C-Myc tag HG16398-CM
RPL18A cDNA ORF Clone, Human, N-Myc tag HG16398-NM
RPL18A qPCR Primer Pairs, Human HP105147
info info
添加购物车成功! 添加购物车失败!