RPL13A cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51229-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL13A Reagents
CRO Services
Product recommended

All RPL13A Reagents
RPL13A cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
612 bp
Description
Full length Clone DNA of Mouse ribosomal protein L13A with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL13A cDNA ORF Clone, Mouse, C-HA tag Alternative Names
1810026N22Rik cDNA ORF Clone, Mouse;Tstap198-7 cDNA ORF Clone, Mouse;tum-antigen cDNA ORF Clone, Mouse
RPL13A Background Information
Full Name
ribosomal protein L13A

RPL13A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPL13A cDNA ORF Clone in Cloning Vector, Rat RG85817-U
RPL13A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85817-ACGLN

RPL13A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL13A cDNA ORF Clone in Cloning Vector, Mouse MG51229-U
RPL13A cDNA ORF Clone, Mouse, untagged MG51229-UT
RPL13A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51229-ACGLN
RPL13A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51229-ACG
RPL13A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51229-ANG
RPL13A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51229-ACR
RPL13A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51229-ANR
RPL13A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51229-CF
RPL13A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51229-NF
RPL13A cDNA ORF Clone, Mouse, C-His tag MG51229-CH
RPL13A cDNA ORF Clone, Mouse, N-His tag MG51229-NH
RPL13A cDNA ORF Clone, Mouse, N-HA tag MG51229-NY
RPL13A cDNA ORF Clone, Mouse, C-Myc tag MG51229-CM
RPL13A cDNA ORF Clone, Mouse, N-Myc tag MG51229-NM
RPL13A qPCR Primer Pairs, Mouse MP201112

RPL13A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL13A cDNA ORF Clone in Cloning Vector, Human HG16501-G
RPL13A cDNA ORF Clone, Human, untagged HG16501-UT
RPL13A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16501-ACGLN
RPL13A cDNA ORF Clone, Human, C-GFPSpark® tag HG16501-ACG
RPL13A cDNA ORF Clone, Human, N-GFPSpark® tag HG16501-ANG
RPL13A cDNA ORF Clone, Human, C-OFPSpark® tag HG16501-ACR
RPL13A cDNA ORF Clone, Human, N-OFPSpark® tag HG16501-ANR
RPL13A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16501-CF
RPL13A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16501-NF
RPL13A cDNA ORF Clone, Human, C-His tag HG16501-CH
RPL13A cDNA ORF Clone, Human, N-His tag HG16501-NH
RPL13A cDNA ORF Clone, Human, C-HA tag HG16501-CY
RPL13A cDNA ORF Clone, Human, N-HA tag HG16501-NY
RPL13A cDNA ORF Clone, Human, C-Myc tag HG16501-CM
RPL13A cDNA ORF Clone, Human, N-Myc tag HG16501-NM
info info
添加购物车成功! 添加购物车失败!