RPL13 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52916-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPL13 Reagents
CRO Services
Product recommended

All RPL13 Reagents
RPL13 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
636 bp
Description
Full length Clone DNA of Mouse ribosomal protein L13 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL13 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
A52 cDNA ORF Clone, Mouse;L13 cDNA ORF Clone, Mouse
RPL13 Background Information
Full Name
ribosomal protein L13

RPL13 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
RPL13 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90590-G
RPL13 cDNA ORF Clone, Cynomolgus, untagged CG90590-UT
RPL13 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90590-ACGLN
RPL13 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90590-ACG
RPL13 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90590-ANG
RPL13 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90590-ACR
RPL13 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90590-ANR
RPL13 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90590-CF
RPL13 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90590-NF
RPL13 cDNA ORF Clone, Cynomolgus, C-His tag CG90590-CH
RPL13 cDNA ORF Clone, Cynomolgus, N-His tag CG90590-NH
RPL13 cDNA ORF Clone, Cynomolgus, C-HA tag CG90590-CY
RPL13 cDNA ORF Clone, Cynomolgus, N-HA tag CG90590-NY
RPL13 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90590-CM
RPL13 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90590-NM

RPL13 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPL13 cDNA ORF Clone in Cloning Vector, Rat RG80480-U
RPL13 cDNA ORF Clone, Rat, untagged RG80480-UT
RPL13 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80480-ACG
RPL13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80480-ACGLN
RPL13 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80480-ANG
RPL13 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80480-ACR
RPL13 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80480-ANR
RPL13 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80480-CF
RPL13 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80480-NF
RPL13 cDNA ORF Clone, Rat, C-His tag RG80480-CH
RPL13 cDNA ORF Clone, Rat, N-His tag RG80480-NH
RPL13 cDNA ORF Clone, Rat, C-HA tag RG80480-CY
RPL13 cDNA ORF Clone, Rat, N-HA tag RG80480-NY
RPL13 cDNA ORF Clone, Rat, C-Myc tag RG80480-CM
RPL13 cDNA ORF Clone, Rat, N-Myc tag RG80480-NM
RPL13 qPCR Primer Pairs, Rat RP300444

RPL13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL13 cDNA ORF Clone in Cloning Vector, Mouse MG52916-G
RPL13 cDNA ORF Clone, Mouse, untagged MG52916-UT
RPL13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52916-ACGLN
RPL13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52916-ACG
RPL13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52916-ACR
RPL13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52916-CF
RPL13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52916-NF
RPL13 cDNA ORF Clone, Mouse, C-His tag MG52916-CH
RPL13 cDNA ORF Clone, Mouse, N-His tag MG52916-NH
RPL13 cDNA ORF Clone, Mouse, C-HA tag MG52916-CY
RPL13 cDNA ORF Clone, Mouse, N-HA tag MG52916-NY
RPL13 cDNA ORF Clone, Mouse, N-Myc tag MG52916-NM

RPL13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL13 cDNA ORF Clone in Cloning Vector, Human HG20712-U
info info
添加购物车成功! 添加购物车失败!