RNMT cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52146-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RNMT Reagents
CRO Services
Product recommended

All RNMT Reagents
RNMT cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Description
Full length Clone DNA of Mouse RNA (guanine-7-) methyltransferase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNMT cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2610002P10Rik cDNA ORF Clone, Mouse;AI848273 cDNA ORF Clone, Mouse;mKIAA0398 cDNA ORF Clone, Mouse;Rg7mt1 cDNA ORF Clone, Mouse
RNMT Background Information
Full Name
RNA (guanine-7-) methyltransferase

RNMT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNMT cDNA ORF Clone in Cloning Vector, Mouse MG52146-G
RNMT cDNA ORF Clone, Mouse, untagged MG52146-UT
RNMT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52146-ACGLN
RNMT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52146-ACG
RNMT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52146-ANG
RNMT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52146-ACR
RNMT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52146-ANR
RNMT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52146-CF
RNMT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52146-NF
RNMT cDNA ORF Clone, Mouse, C-His tag MG52146-CH
RNMT cDNA ORF Clone, Mouse, N-His tag MG52146-NH
RNMT cDNA ORF Clone, Mouse, C-HA tag MG52146-CY
RNMT cDNA ORF Clone, Mouse, N-HA tag MG52146-NY
RNMT cDNA ORF Clone, Mouse, C-Myc tag MG52146-CM
RNMT qPCR Primer Pairs, Mouse MP202019

RNMT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNMT cDNA ORF Clone in Cloning Vector, Human HG16511-G
RNMT cDNA ORF Clone, Human, untagged HG16511-UT
RNMT cDNA ORF Clone, Human, C-GFPSpark® tag HG16511-ACG
RNMT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16511-ACGLN
RNMT cDNA ORF Clone, Human, N-GFPSpark® tag HG16511-ANG
RNMT cDNA ORF Clone, Human, C-OFPSpark® tag HG16511-ACR
RNMT cDNA ORF Clone, Human, N-OFPSpark® tag HG16511-ANR
RNMT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16511-CF
RNMT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16511-NF
RNMT cDNA ORF Clone, Human, C-His tag HG16511-CH
RNMT cDNA ORF Clone, Human, N-His tag HG16511-NH
RNMT cDNA ORF Clone, Human, C-HA tag HG16511-CY
RNMT cDNA ORF Clone, Human, N-HA tag HG16511-NY
RNMT cDNA ORF Clone, Human, C-Myc tag HG16511-CM
RNMT cDNA ORF Clone, Human, N-Myc tag HG16511-NM
info info
添加购物车成功! 添加购物车失败!