RNF26 cDNA ORF Clone, Mouse, untagged

Cat: MG52567-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RNF26 Reagents
CRO Services
Product recommended

All RNF26 Reagents
RNF26 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Mouse ring finger protein 26.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNF26 cDNA ORF Clone, Mouse, untagged Alternative Names
8030450I18Rik cDNA ORF Clone, Mouse
RNF26 Background Information
Full Name
ring finger protein 26

RNF26 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNF26 cDNA ORF Clone in Cloning Vector, Mouse MG52567-G
RNF26 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52567-ACG
RNF26 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52567-ACGLN
RNF26 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52567-ANG
RNF26 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52567-ACR
RNF26 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52567-ANR
RNF26 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52567-CF
RNF26 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52567-NF
RNF26 cDNA ORF Clone, Mouse, C-His tag MG52567-CH
RNF26 cDNA ORF Clone, Mouse, N-His tag MG52567-NH
RNF26 cDNA ORF Clone, Mouse, C-HA tag MG52567-CY
RNF26 cDNA ORF Clone, Mouse, N-HA tag MG52567-NY
RNF26 cDNA ORF Clone, Mouse, C-Myc tag MG52567-CM
RNF26 cDNA ORF Clone, Mouse, N-Myc tag MG52567-NM
RNF26 qPCR Primer Pairs, Mouse MP202439

RNF26 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNF26 cDNA ORF Clone in Cloning Vector, Human HG16635-U
RNF26 cDNA ORF Clone, Human, untagged HG16635-UT
RNF26 cDNA ORF Clone, Human, C-GFPSpark® tag HG16635-ACG
RNF26 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16635-ACGLN
RNF26 cDNA ORF Clone, Human, C-OFPSpark® tag HG16635-ACR
RNF26 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16635-CF
RNF26 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16635-NF
RNF26 cDNA ORF Clone, Human, C-His tag HG16635-CH
RNF26 cDNA ORF Clone, Human, N-His tag HG16635-NH
RNF26 cDNA ORF Clone, Human, C-HA tag HG16635-CY
RNF26 cDNA ORF Clone, Human, N-HA tag HG16635-NY
RNF26 cDNA ORF Clone, Human, C-Myc tag HG16635-CM
RNF26 cDNA ORF Clone, Human, N-Myc tag HG16635-NM
info info
添加购物车成功! 添加购物车失败!