RNF14 cDNA ORF Clone, Mouse, untagged

Cat: MG51534-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RNF14 Reagents
CRO Services
Product recommended

All RNF14 Reagents
RNF14 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1458 bp
Description
Full length Clone DNA of Mouse ring finger protein 14.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNF14 cDNA ORF Clone, Mouse, untagged Alternative Names
2310075C09Rik cDNA ORF Clone, Mouse;2610005D23Rik cDNA ORF Clone, Mouse;AA986456 cDNA ORF Clone, Mouse;AU041447 cDNA ORF Clone, Mouse;D18Ertd188e cDNA ORF Clone, Mouse;D7Bwg0165e cDNA ORF Clone, Mouse;Triad2 cDNA ORF Clone, Mouse
RNF14 Background Information
Full Name
ring finger protein 14

RNF14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNF14 cDNA ORF Clone in Cloning Vector, Mouse MG51534-G
RNF14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51534-ACGLN
RNF14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51534-ACG
RNF14 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51534-ANG
RNF14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51534-ACR
RNF14 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51534-ANR
RNF14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51534-CF
RNF14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51534-NF
RNF14 cDNA ORF Clone, Mouse, C-His tag MG51534-CH
RNF14 cDNA ORF Clone, Mouse, N-His tag MG51534-NH
RNF14 cDNA ORF Clone, Mouse, C-HA tag MG51534-CY
RNF14 cDNA ORF Clone, Mouse, N-HA tag MG51534-NY
RNF14 cDNA ORF Clone, Mouse, C-Myc tag MG51534-CM
RNF14 cDNA ORF Clone, Mouse, N-Myc tag MG51534-NM
RNF14 qPCR Primer Pairs, Mouse MP201418

RNF14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNF14 cDNA ORF Clone in Cloning Vector, Human HG16552-U
RNF14 cDNA ORF Clone, Human, untagged HG16552-UT
RNF14 cDNA ORF Clone, Human, C-GFPSpark® tag HG16552-ACG
RNF14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16552-ACGLN
RNF14 cDNA ORF Clone, Human, N-GFPSpark® tag HG16552-ANG
RNF14 cDNA ORF Clone, Human, C-OFPSpark® tag HG16552-ACR
RNF14 cDNA ORF Clone, Human, N-OFPSpark® tag HG16552-ANR
RNF14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16552-CF
RNF14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16552-NF
RNF14 cDNA ORF Clone, Human, C-His tag HG16552-CH
RNF14 cDNA ORF Clone, Human, N-His tag HG16552-NH
RNF14 cDNA ORF Clone, Human, C-HA tag HG16552-CY
RNF14 cDNA ORF Clone, Human, N-HA tag HG16552-NY
RNF14 cDNA ORF Clone, Human, C-Myc tag HG16552-CM
RNF14 cDNA ORF Clone, Human, N-Myc tag HG16552-NM
info info
添加购物车成功! 添加购物车失败!