RNASEL/RNS4 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG51054-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RNASEL/RNS4 Reagents
CRO Services
Product recommended

All RNASEL/RNS4 Reagents
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2208 bp
Description
Full length Clone DNA of Mouse ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)S with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNASEL/RNS4 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
E230029I04Rik cDNA ORF Clone, Mouse
RNASEL/RNS4 Background Information
Full Name
ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)

RNASEL/RNS4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNASEL/RNS4 cDNA ORF Clone in Cloning Vector, Mouse MG51054-G
RNASEL/RNS4 cDNA ORF Clone, Mouse, untagged MG51054-UT
RNASEL/RNS4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51054-ACGLN
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51054-ACG
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51054-ANG
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51054-ACR
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51054-ANR
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51054-CF
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51054-NF
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-His tag MG51054-CH
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-His tag MG51054-NH
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-HA tag MG51054-CY
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-Myc tag MG51054-CM
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-Myc tag MG51054-NM
RNASEL/RNS4 qPCR Primer Pairs, Mouse MP201012

RNASEL/RNS4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNASEL/RNS4 cDNA ORF Clone in Cloning Vector, Human HG10858-M
RNASEL/RNS4 cDNA ORF Clone, Human, untagged HG10858-UT
RNASEL/RNS4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10858-ACGLN
RNASEL/RNS4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10858-ACG
RNASEL/RNS4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10858-ANG
RNASEL/RNS4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10858-ACR
RNASEL/RNS4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10858-ANR
RNASEL/RNS4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10858-CF
RNASEL/RNS4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10858-NF
RNASEL/RNS4 cDNA ORF Clone, Human, C-His tag HG10858-CH
RNASEL/RNS4 cDNA ORF Clone, Human, N-His tag HG10858-NH
RNASEL/RNS4 cDNA ORF Clone, Human, C-HA tag HG10858-CY
RNASEL/RNS4 cDNA ORF Clone, Human, N-HA tag HG10858-NY
RNASEL/RNS4 cDNA ORF Clone, Human, C-Myc tag HG10858-CM
RNASEL/RNS4 cDNA ORF Clone, Human, N-Myc tag HG10858-NM
RNASEL/RNS4 qPCR Primer Pairs, Human HP100925
info info
添加购物车成功! 添加购物车失败!