RNASEH2B cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51889-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RNASEH2B Reagents
CRO Services
Product recommended

All RNASEH2B Reagents
RNASEH2B cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
927 bp
Description
Full length Clone DNA of Mouse ribonuclease H2, subunit B with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNASEH2B cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1110019N06Rik cDNA ORF Clone, Mouse;2610207P08Rik cDNA ORF Clone, Mouse;Dleu8 cDNA ORF Clone, Mouse
RNASEH2B Background Information
Full Name
ribonuclease H2, subunit B

RNASEH2B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNASEH2B cDNA ORF Clone in Cloning Vector, Mouse MG51889-G
RNASEH2B cDNA ORF Clone, Mouse, untagged MG51889-UT
RNASEH2B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51889-ACGLN
RNASEH2B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51889-ACG
RNASEH2B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51889-ANG
RNASEH2B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51889-ACR
RNASEH2B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51889-ANR
RNASEH2B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51889-CF
RNASEH2B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51889-NF
RNASEH2B cDNA ORF Clone, Mouse, C-His tag MG51889-CH
RNASEH2B cDNA ORF Clone, Mouse, N-His tag MG51889-NH
RNASEH2B cDNA ORF Clone, Mouse, C-HA tag MG51889-CY
RNASEH2B cDNA ORF Clone, Mouse, N-HA tag MG51889-NY
RNASEH2B cDNA ORF Clone, Mouse, N-Myc tag MG51889-NM
RNASEH2B qPCR Primer Pairs, Mouse MP201762

RNASEH2B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNASEH2B cDNA ORF Clone in Cloning Vector, Human HG16943-U
RNASEH2B cDNA ORF Clone, Human, untagged HG16943-UT
RNASEH2B cDNA ORF Clone, Human, C-GFPSpark® tag HG16943-ACG
RNASEH2B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16943-ACGLN
RNASEH2B cDNA ORF Clone, Human, N-GFPSpark® tag HG16943-ANG
RNASEH2B cDNA ORF Clone, Human, C-OFPSpark® tag HG16943-ACR
RNASEH2B cDNA ORF Clone, Human, N-OFPSpark® tag HG16943-ANR
RNASEH2B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16943-CF
RNASEH2B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16943-NF
RNASEH2B cDNA ORF Clone, Human, C-His tag HG16943-CH
RNASEH2B cDNA ORF Clone, Human, N-His tag HG16943-NH
RNASEH2B cDNA ORF Clone, Human, C-HA tag HG16943-CY
RNASEH2B cDNA ORF Clone, Human, N-HA tag HG16943-NY
RNASEH2B cDNA ORF Clone, Human, C-Myc tag HG16943-CM
RNASEH2B cDNA ORF Clone, Human, N-Myc tag HG16943-NM
info info
添加购物车成功! 添加购物车失败!