RNASEH1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51593-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RNASEH1 Reagents
CRO Services
Product recommended

All RNASEH1 Reagents
RNASEH1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
858 bp
Description
Full length Clone DNA of Mouse ribonuclease H1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNASEH1 Background Information
Full Name
ribonuclease H1

RNASEH1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNASEH1 cDNA ORF Clone in Cloning Vector, Mouse MG51593-G
RNASEH1 cDNA ORF Clone, Mouse, untagged MG51593-UT
RNASEH1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51593-ACGLN
RNASEH1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51593-ACG
RNASEH1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51593-ANG
RNASEH1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51593-ACR
RNASEH1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51593-ANR
RNASEH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51593-CF
RNASEH1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51593-NF
RNASEH1 cDNA ORF Clone, Mouse, C-His tag MG51593-CH
RNASEH1 cDNA ORF Clone, Mouse, N-His tag MG51593-NH
RNASEH1 cDNA ORF Clone, Mouse, C-HA tag MG51593-CY
RNASEH1 cDNA ORF Clone, Mouse, N-HA tag MG51593-NY
RNASEH1 cDNA ORF Clone, Mouse, C-Myc tag MG51593-CM
RNASEH1 qPCR Primer Pairs, Mouse MP201476

RNASEH1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNASEH1 cDNA ORF Clone in Cloning Vector, Human HG17143-U
RNASEH1 cDNA ORF Clone, Human, untagged HG17143-UT
RNASEH1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17143-ACG
RNASEH1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17143-ACGLN
RNASEH1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17143-ANG
RNASEH1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17143-ACR
RNASEH1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17143-ANR
RNASEH1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17143-CF
RNASEH1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17143-NF
RNASEH1 cDNA ORF Clone, Human, C-His tag HG17143-CH
RNASEH1 cDNA ORF Clone, Human, N-His tag HG17143-NH
RNASEH1 cDNA ORF Clone, Human, C-HA tag HG17143-CY
RNASEH1 cDNA ORF Clone, Human, N-HA tag HG17143-NY
RNASEH1 cDNA ORF Clone, Human, C-Myc tag HG17143-CM
RNASEH1 cDNA ORF Clone, Human, N-Myc tag HG17143-NM
info info
添加购物车成功! 添加购物车失败!