Quick Order

Mouse RIC8B Gene ORF cDNA clone expression plasmid

  • Human CD112/Nectin-2/PVRL2 Gene Plasmid Map 5681
DatasheetReviewsRelated ProductsProtocols
Mouse RIC8B cDNA Clone Product Information
NCBI RefSeq:NM_183172.2
RefSeq ORF Size:1683bp
cDNA Description:Full length Clone DNA of Mus musculus resistance to inhibitors of cholinesterase 8 homolog B (C. elegans).
Gene Synonym:Ric-8, Ric-8b, BC051080
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mRic8b
Restriction Site:HindIII + NotI(6.1kb+1.68kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RIC8B qPCR primers for gene expression analysis, MP201542 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG51669-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"