Resistin cDNA ORF Clone, Mouse, C-His tag

Cat: MG50488-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Resistin Reagents
CRO Services
Product recommended

All Resistin Reagents
Resistin cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
345 bp
Description
Full length Clone DNA of Mouse Resistin with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Resistin cDNA ORF Clone, Mouse, C-His tag Alternative Names
ADSF cDNA ORF Clone, Mouse;Fizz3 cDNA ORF Clone, Mouse;Rstn cDNA ORF Clone, Mouse;Xcp4 cDNA ORF Clone, Mouse
Resistin Background Information
Full Name
resistin
References
  • Verma S, et al. (2003) Resistin promotes endothelial cell activation: further evidence of adipokine-endothelial interaction. Circulation. 108(6):736-40.
  • Reilly MP, et al. (2005) Resistin is an inflammatory marker of atherosclerosis in humans. Circulation. 111(7):932-9.
  • Steppan CM, et al. (2002) Resistin and obesity-associated insulin resistance. Trends Endocrinol Metab. 13(1):18-23.
  • Resistin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Resistin cDNA ORF Clone in Cloning Vector, Mouse MG50488-M
    Resistin cDNA ORF Clone, Mouse, untagged MG50488-UT
    Resistin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50488-ACG
    Resistin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50488-ACGLN
    Resistin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50488-ACR
    Resistin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50488-CF
    Resistin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50488-NF
    Resistin cDNA ORF Clone, Mouse, N-His tag MG50488-NH
    Resistin cDNA ORF Clone, Mouse, C-HA tag MG50488-CY
    Resistin cDNA ORF Clone, Mouse, N-HA tag MG50488-NY
    Resistin cDNA ORF Clone, Mouse, C-Myc tag MG50488-CM
    Resistin cDNA ORF Clone, Mouse, N-Myc tag MG50488-NM
    Resistin qPCR Primer Pairs, Mouse MP200482

    Resistin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Resistin cDNA ORF Clone in Cloning Vector, Human HG13055-G
    Resistin cDNA ORF Clone, Human, untagged HG13055-UT
    Resistin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13055-ACGLN
    Resistin cDNA ORF Clone, Human, C-GFPSpark® tag HG13055-ACG
    Resistin cDNA ORF Clone, Human, C-OFPSpark® tag HG13055-ACR
    Resistin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13055-CF
    Resistin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13055-NF
    Resistin cDNA ORF Clone, Human, C-His tag HG13055-CH
    Resistin cDNA ORF Clone, Human, N-His tag HG13055-NH
    Resistin cDNA ORF Clone, Human, C-HA tag HG13055-CY
    Resistin cDNA ORF Clone, Human, N-HA tag HG13055-NY
    Resistin cDNA ORF Clone, Human, C-Myc tag HG13055-CM
    Resistin cDNA ORF Clone, Human, N-Myc tag HG13055-NM
    Resistin qPCR Primer Pairs, Human HP101674
    info info
    添加购物车成功! 添加购物车失败!