RER1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52253-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RER1 Reagents
CRO Services
Product recommended

All RER1 Reagents
RER1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
591 bp
Description
Full length Clone DNA of Mouse RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RER1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1110060F11Rik cDNA ORF Clone, Mouse;5830454N22Rik cDNA ORF Clone, Mouse;AU043380 cDNA ORF Clone, Mouse
RER1 Background Information
Full Name
retention in endoplasmic reticulum sorting receptor 1

RER1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RER1 cDNA ORF Clone in Cloning Vector, Rat RG8A0073-U
RER1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0073-ACGLN

RER1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RER1 cDNA ORF Clone in Cloning Vector, Mouse MG52253-G
RER1 cDNA ORF Clone, Mouse, untagged MG52253-UT
RER1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52253-ACG
RER1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52253-ACGLN
RER1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52253-ANG
RER1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52253-ACR
RER1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52253-ANR
RER1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52253-NF
RER1 cDNA ORF Clone, Mouse, C-His tag MG52253-CH
RER1 cDNA ORF Clone, Mouse, N-His tag MG52253-NH
RER1 cDNA ORF Clone, Mouse, C-HA tag MG52253-CY
RER1 cDNA ORF Clone, Mouse, N-HA tag MG52253-NY
RER1 cDNA ORF Clone, Mouse, C-Myc tag MG52253-CM
RER1 cDNA ORF Clone, Mouse, N-Myc tag MG52253-NM
RER1 qPCR Primer Pairs, Mouse MP202126

RER1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RER1 cDNA ORF Clone in Cloning Vector, Human HG23150-U
RER1 cDNA ORF Clone, Human, untagged HG23150-UT
RER1 cDNA ORF Clone, Human, C-GFPSpark® tag HG23150-ACG
RER1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23150-ACGLN
RER1 cDNA ORF Clone, Human, N-GFPSpark® tag HG23150-ANG
RER1 cDNA ORF Clone, Human, C-OFPSpark® tag HG23150-ACR
RER1 cDNA ORF Clone, Human, N-OFPSpark® tag HG23150-ANR
RER1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23150-CF
RER1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23150-NF
RER1 cDNA ORF Clone, Human, C-His tag HG23150-CH
RER1 cDNA ORF Clone, Human, N-His tag HG23150-NH
RER1 cDNA ORF Clone, Human, C-HA tag HG23150-CY
RER1 cDNA ORF Clone, Human, N-HA tag HG23150-NY
RER1 cDNA ORF Clone, Human, C-Myc tag HG23150-CM
RER1 cDNA ORF Clone, Human, N-Myc tag HG23150-NM
info info
添加购物车成功! 添加购物车失败!