REG4 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50202-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All REG4 Reagents
CRO Services
Product recommended

All REG4 Reagents
REG4 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
474 bp
Description
Full length Clone DNA of Mouse regenerating islet-derived family, member 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

REG4 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2010002L15Rik cDNA ORF Clone, Mouse;GISP cDNA ORF Clone, Mouse;RELP cDNA ORF Clone, Mouse
REG4 Background Information

Regenerating islet-derived protein 4, also known as REG-like protein, REG4, GISP and RELP, a member of the regenerating gene family belonging to the calcium (C-type) dependent lectin superfamily, has been found to be involved in malignancy in several different organs including the stomach, colorectum, pancreas and prostate. It is highly expressed in the gastrointestinal tract and markedly up-regulated in colon adenocarcinoma, pancreatic cancer, gastric adenocarcinoma, and inflammatory bowel disease. Expression of the Reg4 in different cell types has been associated with regeneration, cell growth and cell survival, cell adhesion and resistance to apoptosis. REG4 protein overexpression is associated with an unfavorable response to preoperative chemoradiotherapy and may be used as a predictive biomarker clinically. REG4 may play an important role in the development and progression of colorectal cancer, as well as in intestinal morphogenesis and epithelium restitution.

Full Name
regenerating islet-derived family, member 4
References
  • Li FY, et al. (2010) RegIV expression showing specificity to gastrointestinal tract and its potential role in diagnosing digestive tract neuroendocrine tumor. J Zhejiang Univ Sci B. 11(4):258-66.
  • Rafa L, et al. (2010) REG4 acts as a mitogenic, motility and pro-invasive factor for colon cancer cells. Int J Oncol. 36(3): 689-98.
  • Hu G, et al. (2010) Purification of a bioactive recombinant human Reg IV expressed in Escherichia coli. Protein Expr Purif. 69(2): 186-90.
  • REG4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    REG4 cDNA ORF Clone in Cloning Vector, Rat RG80249-G
    REG4 cDNA ORF Clone, Rat, untagged RG80249-UT
    REG4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80249-ACGLN
    REG4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80249-ACG
    REG4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80249-ACR
    REG4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80249-CF
    REG4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80249-NF
    REG4 cDNA ORF Clone, Rat, C-His tag RG80249-CH
    REG4 cDNA ORF Clone, Rat, N-His tag RG80249-NH
    REG4 cDNA ORF Clone, Rat, C-HA tag RG80249-CY
    REG4 cDNA ORF Clone, Rat, N-HA tag RG80249-NY
    REG4 cDNA ORF Clone, Rat, C-Myc tag RG80249-CM
    REG4 cDNA ORF Clone, Rat, N-Myc tag RG80249-NM
    REG4 qPCR Primer Pairs, Rat RP300234

    REG4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    REG4 cDNA ORF Clone in Cloning Vector, Mouse MG50202-M
    REG4 cDNA ORF Clone, Mouse, untagged MG50202-UT
    REG4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50202-ACGLN
    REG4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50202-ACG
    REG4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50202-ACR
    REG4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50202-CF
    REG4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50202-NF
    REG4 cDNA ORF Clone, Mouse, C-His tag MG50202-CH
    REG4 cDNA ORF Clone, Mouse, C-HA tag MG50202-CY
    REG4 cDNA ORF Clone, Mouse, N-HA tag MG50202-NY
    REG4 cDNA ORF Clone, Mouse, C-Myc tag MG50202-CM
    REG4 cDNA ORF Clone, Mouse, N-Myc tag MG50202-NM
    REG4 qPCR Primer Pairs, Mouse MP200231

    REG4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    REG4 cDNA ORF Clone in Cloning Vector, Human HG11186-M
    REG4 cDNA ORF Clone, Human, untagged HG11186-UT
    REG4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11186-ACGLN
    REG4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11186-ACG
    REG4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11186-ACR
    REG4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11186-CF
    REG4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11186-NF
    REG4 cDNA ORF Clone, Human, C-His tag HG11186-CH
    REG4 cDNA ORF Clone, Human, N-His tag HG11186-NH
    REG4 cDNA ORF Clone, Human, C-HA tag HG11186-CY
    REG4 cDNA ORF Clone, Human, N-HA tag HG11186-NY
    REG4 cDNA ORF Clone, Human, C-Myc tag HG11186-CM
    REG4 cDNA ORF Clone, Human, N-Myc tag HG11186-NM
    REG4 qPCR Primer Pairs, Human HP101092
    info info
    添加购物车成功! 添加购物车失败!