After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse REG3D Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse REG3D cDNA Clone Product Information
NCBI RefSeq:NM_013893.2
RefSeq ORF Size:528bp
cDNA Description:Full length Clone DNA of Mus musculus regenerating islet-derived 3 delta with C terminal His tag.
Gene Synonym:Ingaprp, MGC130575, Reg3d
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Regenerating islet-derived 3 delta (REG3D) is a member of the secreted Reg superfamily and contains one typical C-type lectin domain. Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family, which consists of four subtypes (types I, II, III, IV) based on the primary structures of the encoded proteins of the genes, which are associated with tissue repair and have been directly implicated in pancreatic beta-cell regeneration. Reg proteins are expressed in various organs and are involved in cancers and neurodegenerative diseases. They display a typical C-type lectin-like domain but possess additional highly conserved amino acids.

References
  • Laurine E, et al. (2005) PAP IB, a new member of the Reg gene family: cloning, expression, structural properties, and evolution by gene duplication. Biochim Biophys Acta. 1727 (3): 177-87.
  • Hillier LW, et al. (2005) Generation and annotation of the DNA sequences of human chromosomes 2 and 4. Nature 434 (7034): 724-31.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99 (26): 16899-903.
  • Size / Price
    Catalog: MG50540-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"