RCN2 cDNA ORF Clone, Mouse, untagged

Cat: MG51591-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RCN2 Reagents
CRO Services
Product recommended

All RCN2 Reagents
RCN2 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
963 bp
Description
Full length Clone DNA of Mouse reticulocalbin 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RCN2 cDNA ORF Clone, Mouse, untagged Alternative Names
AA408742 cDNA ORF Clone, Mouse;Tcbp49 cDNA ORF Clone, Mouse
RCN2 Background Information
Full Name
reticulocalbin 2, EF-hand calcium binding domain

RCN2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RCN2 cDNA ORF Clone in Cloning Vector, Mouse MG5A7592-U
RCN2 cDNA ORF Clone in Cloning Vector, Mouse MG51591-G
RCN2 cDNA ORF Clone, Mouse, untagged MG5A7592-UT
RCN2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51591-ACG
RCN2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51591-ACGLN
RCN2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7592-ACG
RCN2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7592-ACGLN
RCN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7592-ACR
RCN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51591-ACR
RCN2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7592-CF
RCN2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51591-CF
RCN2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7592-NF
RCN2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51591-NF
RCN2 cDNA ORF Clone, Mouse, C-His tag MG51591-CH
RCN2 cDNA ORF Clone, Mouse, C-His tag MG5A7592-CH
RCN2 cDNA ORF Clone, Mouse, N-His tag MG51591-NH
RCN2 cDNA ORF Clone, Mouse, N-His tag MG5A7592-NH
RCN2 cDNA ORF Clone, Mouse, C-HA tag MG51591-CY
RCN2 cDNA ORF Clone, Mouse, C-HA tag MG5A7592-CY
RCN2 cDNA ORF Clone, Mouse, N-HA tag MG51591-NY
RCN2 cDNA ORF Clone, Mouse, N-HA tag MG5A7592-NY
RCN2 cDNA ORF Clone, Mouse, C-Myc tag MG5A7592-CM
RCN2 cDNA ORF Clone, Mouse, C-Myc tag MG51591-CM
RCN2 cDNA ORF Clone, Mouse, N-Myc tag MG51591-NM
RCN2 cDNA ORF Clone, Mouse, N-Myc tag MG5A7592-NM
RCN2 qPCR Primer Pairs, Mouse MP201474

RCN2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RCN2 cDNA ORF Clone in Cloning Vector, Human HG20476-U
RCN2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20476-ACGLN
info info
添加购物车成功! 添加购物车失败!