RBP4 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50170-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RBP4 Reagents
CRO Services
Product recommended

All RBP4 Reagents
RBP4 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
645 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 516G/A,558T/C not causing the amino acid variation.
Description
Full length Clone DNA of Mouse retinol binding protein 4, plasma with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Restriction Sites
KpnI + XbaI(6kb+0.65kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RBP4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RBP4 cDNA ORF Clone, Mouse, N-His tag Validated Images
Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
RBP4 cDNA ORF Clone, Mouse, N-His tag Alternative Names
Rbp-4 cDNA ORF Clone, Mouse
RBP4 Background Information

Retinol-binding protein 4 (RBP4) is the specific carrier for retinol (also known as vitamin A), and is responsible for the conversion of unstable and insoluble retinol in aqueous solution into stable and soluble complex in plasma through their tight interaction. As a member of the lipocalin superfamily, RBP4 containing a β-barrel structure with a well-defined cavity is secreted from the liver, and in turn delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP4-retinol complex interacts with transthyretin (TTR), and this binding is crucial for preventing RBP4 excretion through the kidney glomeruli. RBP4 expressed from an ectopic source efficiently delivers retinol to the eyes, and its deficiency affects night vision largely. Recently, RBP4 as an adipokine, is found to be expressed in adipose tissue and correlated with obesity, insulin resistance (IR) and type 2 diabetes (T2DM).

Full Name
retinol binding protein 4, plasma
References
  • Yang Q, et al. (2005) Serum retinol binding protein 4 contributes to insulin resistance in obesity and type 2 diabetes. Nature. 436(7049): 356-62.
  • Choi SH, et al. (2008) High plasma retinol binding protein-4 and low plasma adiponectin concentrations are associated with severity of glucose intolerance in women with previous gestational diabetes mellitus. J Clin Endocrinol Metab. 93(8): 3142-8.
  • Tepper BJ, et al. (2010) Serum retinol-binding protein 4 (RBP4) and retinol in a cohort of borderline obese women with and without gestational diabetes. Clin Biochem. 43(3): 320-3.
  • RBP4 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    RBP4 cDNA ORF Clone in Cloning Vector, Canine DG70006-G
    RBP4 cDNA ORF Clone, Canine, untagged DG70006-UT
    RBP4 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70006-ACG
    RBP4 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70006-ACGLN
    RBP4 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70006-ACR
    RBP4 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70006-CF
    RBP4 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70006-NF
    RBP4 cDNA ORF Clone, Canine, C-His tag DG70006-CH
    RBP4 cDNA ORF Clone, Canine, N-His tag DG70006-NH
    RBP4 cDNA ORF Clone, Canine, C-HA tag DG70006-CY
    RBP4 cDNA ORF Clone, Canine, N-HA tag DG70006-NY
    RBP4 cDNA ORF Clone, Canine, C-Myc tag DG70006-CM
    RBP4 cDNA ORF Clone, Canine, N-Myc tag DG70006-NM

    RBP4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    RBP4 cDNA ORF Clone in Cloning Vector, Rat RG80008-G
    RBP4 cDNA ORF Clone, Rat, untagged RG80008-UT
    RBP4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80008-ACG
    RBP4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80008-ACGLN
    RBP4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80008-ACR
    RBP4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80008-CF
    RBP4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80008-NF
    RBP4 cDNA ORF Clone, Rat, C-His tag RG80008-CH
    RBP4 cDNA ORF Clone, Rat, N-His tag RG80008-NH
    RBP4 cDNA ORF Clone, Rat, C-HA tag RG80008-CY
    RBP4 cDNA ORF Clone, Rat, N-HA tag RG80008-NY
    RBP4 cDNA ORF Clone, Rat, C-Myc tag RG80008-CM
    RBP4 cDNA ORF Clone, Rat, N-Myc tag RG80008-NM
    RBP4 qPCR Primer Pairs, Rat RP300007

    RBP4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RBP4 cDNA ORF Clone in Cloning Vector, Mouse MG50170-M
    RBP4 cDNA ORF Clone, Mouse, untagged MG50170-UT
    RBP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50170-ACG
    RBP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50170-ACGLN
    RBP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50170-ACR
    RBP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50170-CF
    RBP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50170-NF
    RBP4 cDNA ORF Clone, Mouse, C-His tag MG50170-CH
    RBP4 cDNA ORF Clone, Mouse, C-HA tag MG50170-CY
    RBP4 cDNA ORF Clone, Mouse, N-HA tag MG50170-NY
    RBP4 cDNA ORF Clone, Mouse, C-Myc tag MG50170-CM
    RBP4 cDNA ORF Clone, Mouse, N-Myc tag MG50170-NM
    RBP4 qPCR Primer Pairs, Mouse MP200200

    RBP4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RBP4 cDNA ORF Clone in Cloning Vector, Human HG10354-M
    RBP4 cDNA ORF Clone, Human, untagged HG10354-UT
    RBP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10354-ACG
    RBP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10354-ACGLN
    RBP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10354-ACR
    RBP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10354-CF
    RBP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10354-NF
    RBP4 cDNA ORF Clone, Human, C-His tag HG10354-CH
    RBP4 cDNA ORF Clone, Human, N-His tag HG10354-NH
    RBP4 cDNA ORF Clone, Human, C-HA tag HG10354-CY
    RBP4 cDNA ORF Clone, Human, N-HA tag HG10354-NY
    RBP4 cDNA ORF Clone, Human, C-Myc tag HG10354-CM
    RBP4 cDNA ORF Clone, Human, N-Myc tag HG10354-NM
    RBP4 qPCR Primer Pairs, Human HP100080
    info info
    添加购物车成功! 添加购物车失败!