RBM39 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52969-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RBM39 Reagents
CRO Services
Product recommended

All RBM39 Reagents
RBM39 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1575 bp
Description
Full length Clone DNA of Mouse RNA binding motif protein 39 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RBM39 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1500012C14Rik cDNA ORF Clone, Mouse;2310040E03Rik cDNA ORF Clone, Mouse;B330012G18Rik cDNA ORF Clone, Mouse;C79248 cDNA ORF Clone, Mouse;caper cDNA ORF Clone, Mouse;R75070 cDNA ORF Clone, Mouse;Rnpc2 cDNA ORF Clone, Mouse
RBM39 Background Information
Full Name
RNA binding motif protein 39

RBM39 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RBM39 cDNA ORF Clone in Cloning Vector, Rat RG8A6926-U
RBM39 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6926-ACGLN

RBM39 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RBM39 cDNA ORF Clone in Cloning Vector, Mouse MG52969-G
RBM39 cDNA ORF Clone, Mouse, untagged MG52969-UT
RBM39 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52969-ACG
RBM39 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52969-ACGLN
RBM39 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52969-ACR
RBM39 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52969-CF
RBM39 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52969-NF
RBM39 cDNA ORF Clone, Mouse, C-His tag MG52969-CH
RBM39 cDNA ORF Clone, Mouse, C-HA tag MG52969-CY
RBM39 cDNA ORF Clone, Mouse, N-HA tag MG52969-NY
RBM39 cDNA ORF Clone, Mouse, C-Myc tag MG52969-CM
RBM39 cDNA ORF Clone, Mouse, N-Myc tag MG52969-NM

RBM39 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RBM39 cDNA ORF Clone in Cloning Vector, Human HG19470-U
RBM39 cDNA ORF Clone, Human, untagged HG19470-UT
RBM39 cDNA ORF Clone, Human, C-GFPSpark® tag HG19470-ACG
RBM39 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19470-ACGLN
RBM39 cDNA ORF Clone, Human, C-OFPSpark® tag HG19470-ACR
RBM39 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19470-CF
RBM39 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19470-NF
RBM39 cDNA ORF Clone, Human, C-His tag HG19470-CH
RBM39 cDNA ORF Clone, Human, N-His tag HG19470-NH
RBM39 cDNA ORF Clone, Human, C-HA tag HG19470-CY
RBM39 cDNA ORF Clone, Human, N-HA tag HG19470-NY
RBM39 cDNA ORF Clone, Human, C-Myc tag HG19470-CM
RBM39 cDNA ORF Clone, Human, N-Myc tag HG19470-NM
info info
添加购物车成功! 添加购物车失败!