RBM3 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52209-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RBM3 Reagents
CRO Services
Product recommended

All RBM3 Reagents
RBM3 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
465 bp
Description
Full length Clone DNA of Mouse RNA binding motif protein 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RBM3 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
2600016C11Rik cDNA ORF Clone, Mouse
RBM3 Background Information
Full Name
RNA binding motif (RNP1, RRM) protein 3

RBM3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RBM3 cDNA ORF Clone in Cloning Vector, Rhesus CG90380-G
RBM3 cDNA ORF Clone, Rhesus, untagged CG90380-UT
RBM3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90380-ACGLN
RBM3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90380-ACG
RBM3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90380-ANG
RBM3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90380-ACR
RBM3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90380-ANR
RBM3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90380-CF
RBM3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90380-NF
RBM3 cDNA ORF Clone, Rhesus, C-His tag CG90380-CH
RBM3 cDNA ORF Clone, Rhesus, N-His tag CG90380-NH
RBM3 cDNA ORF Clone, Rhesus, C-HA tag CG90380-CY
RBM3 cDNA ORF Clone, Rhesus, N-HA tag CG90380-NY
RBM3 cDNA ORF Clone, Rhesus, C-Myc tag CG90380-CM
RBM3 cDNA ORF Clone, Rhesus, N-Myc tag CG90380-NM

RBM3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RBM3 cDNA ORF Clone in Cloning Vector, Rat RG81239-U
RBM3 cDNA ORF Clone, Rat, untagged RG81239-UT
RBM3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81239-ACG
RBM3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81239-ACGLN
RBM3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81239-ANG
RBM3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81239-ACR
RBM3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81239-ANR
RBM3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81239-CF
RBM3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81239-NF
RBM3 cDNA ORF Clone, Rat, C-His tag RG81239-CH
RBM3 cDNA ORF Clone, Rat, N-His tag RG81239-NH
RBM3 cDNA ORF Clone, Rat, C-HA tag RG81239-CY
RBM3 cDNA ORF Clone, Rat, N-HA tag RG81239-NY
RBM3 cDNA ORF Clone, Rat, C-Myc tag RG81239-CM
RBM3 cDNA ORF Clone, Rat, N-Myc tag RG81239-NM
RBM3 qPCR Primer Pairs, Rat RP301195

RBM3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RBM3 cDNA ORF Clone in Cloning Vector, Mouse MG52209-G
RBM3 cDNA ORF Clone, Mouse, untagged MG52209-UT
RBM3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52209-ACGLN
RBM3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52209-ACG
RBM3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52209-ANG
RBM3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52209-ACR
RBM3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52209-ANR
RBM3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52209-CF
RBM3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52209-NF
RBM3 cDNA ORF Clone, Mouse, C-His tag MG52209-CH
RBM3 cDNA ORF Clone, Mouse, N-His tag MG52209-NH
RBM3 cDNA ORF Clone, Mouse, C-HA tag MG52209-CY
RBM3 cDNA ORF Clone, Mouse, C-Myc tag MG52209-CM
RBM3 cDNA ORF Clone, Mouse, N-Myc tag MG52209-NM
RBM3 qPCR Primer Pairs, Mouse MP202082

RBM3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RBM3 cDNA ORF Clone in Cloning Vector, Human HG16437-U
RBM3 cDNA ORF Clone, Human, untagged HG16437-UT
RBM3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16437-ACG
RBM3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16437-ACGLN
RBM3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16437-ANG
RBM3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16437-ACR
RBM3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16437-ANR
RBM3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16437-CF
RBM3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16437-NF
RBM3 cDNA ORF Clone, Human, C-His tag HG16437-CH
RBM3 cDNA ORF Clone, Human, N-His tag HG16437-NH
RBM3 cDNA ORF Clone, Human, C-HA tag HG16437-CY
RBM3 cDNA ORF Clone, Human, N-HA tag HG16437-NY
RBM3 cDNA ORF Clone, Human, C-Myc tag HG16437-CM
RBM3 cDNA ORF Clone, Human, N-Myc tag HG16437-NM
RBM3 qPCR Primer Pairs, Human HP105185
info info
添加购物车成功! 添加购物车失败!