RBM10 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52280-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RBM10 Reagents
CRO Services
Product recommended

All RBM10 Reagents
RBM10 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2562 bp
Description
Full length Clone DNA of Mouse RNA binding motif protein 10 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RBM10 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
E430039K10Rik cDNA ORF Clone, Mouse
RBM10 Background Information
Full Name
RNA binding motif protein 10

RBM10 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
RBM10 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90699-G
RBM10 cDNA ORF Clone, Cynomolgus, untagged CG90699-UT
RBM10 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90699-ACG
RBM10 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90699-ACGLN
RBM10 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90699-ANG
RBM10 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90699-ACR
RBM10 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90699-ANR
RBM10 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90699-CF
RBM10 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90699-NF
RBM10 cDNA ORF Clone, Cynomolgus, C-His tag CG90699-CH
RBM10 cDNA ORF Clone, Cynomolgus, N-His tag CG90699-NH
RBM10 cDNA ORF Clone, Cynomolgus, C-HA tag CG90699-CY
RBM10 cDNA ORF Clone, Cynomolgus, N-HA tag CG90699-NY
RBM10 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90699-CM
RBM10 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90699-NM

RBM10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RBM10 cDNA ORF Clone in Cloning Vector, Mouse MG52280-G
RBM10 cDNA ORF Clone, Mouse, untagged MG52280-UT
RBM10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52280-ACGLN
RBM10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52280-ACG
RBM10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52280-ANG
RBM10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52280-ACR
RBM10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52280-ANR
RBM10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52280-CF
RBM10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52280-NF
RBM10 cDNA ORF Clone, Mouse, C-His tag MG52280-CH
RBM10 cDNA ORF Clone, Mouse, N-His tag MG52280-NH
RBM10 cDNA ORF Clone, Mouse, C-HA tag MG52280-CY
RBM10 cDNA ORF Clone, Mouse, C-Myc tag MG52280-CM
RBM10 cDNA ORF Clone, Mouse, N-Myc tag MG52280-NM
RBM10 qPCR Primer Pairs, Mouse MP202153

RBM10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RBM10 cDNA ORF Clone in Cloning Vector, Human HG19903-U
RBM10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19903-ACGLN
info info
添加购物车成功! 添加购物车失败!