RAP1A cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52137-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAP1A Reagents
CRO Services
Product recommended

All RAP1A Reagents
RAP1A cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
555 bp
Description
Full length Clone DNA of Mouse RAS-related protein-1a with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAP1A cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AI848598 cDNA ORF Clone, Mouse;G-22K cDNA ORF Clone, Mouse;Krev-1 cDNA ORF Clone, Mouse;Rap1 cDNA ORF Clone, Mouse
RAP1A Background Information
Full Name
RAP1A, member of RAS oncogene family

RAP1A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAP1A cDNA ORF Clone in Cloning Vector, Rat RG81271-U
RAP1A cDNA ORF Clone, Rat, untagged RG81271-UT
RAP1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81271-ACGLN
RAP1A cDNA ORF Clone, Rat, C-GFPSpark® tag RG81271-ACG
RAP1A cDNA ORF Clone, Rat, C-OFPSpark® tag RG81271-ACR
RAP1A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81271-CF
RAP1A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81271-NF
RAP1A cDNA ORF Clone, Rat, C-His tag RG81271-CH
RAP1A cDNA ORF Clone, Rat, N-His tag RG81271-NH
RAP1A cDNA ORF Clone, Rat, C-HA tag RG81271-CY
RAP1A cDNA ORF Clone, Rat, N-HA tag RG81271-NY
RAP1A cDNA ORF Clone, Rat, C-Myc tag RG81271-CM
RAP1A cDNA ORF Clone, Rat, N-Myc tag RG81271-NM
RAP1A qPCR Primer Pairs, Rat RP301227

RAP1A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAP1A cDNA ORF Clone in Cloning Vector, Mouse MG52137-G
RAP1A cDNA ORF Clone, Mouse, untagged MG52137-UT
RAP1A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52137-ACG
RAP1A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52137-ACGLN
RAP1A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52137-ANG
RAP1A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52137-ACR
RAP1A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52137-ANR
RAP1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52137-CF
RAP1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52137-NF
RAP1A cDNA ORF Clone, Mouse, C-His tag MG52137-CH
RAP1A cDNA ORF Clone, Mouse, N-His tag MG52137-NH
RAP1A cDNA ORF Clone, Mouse, C-HA tag MG52137-CY
RAP1A cDNA ORF Clone, Mouse, N-HA tag MG52137-NY
RAP1A cDNA ORF Clone, Mouse, C-Myc tag MG52137-CM
RAP1A qPCR Primer Pairs, Mouse MP202010
info info
添加购物车成功! 添加购物车失败!