RAB8A cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52797-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RAB8A Reagents
CRO Services
Product recommended

All RAB8A Reagents
RAB8A cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Mouse RAB8A, member RAS oncogene family with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB8A cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AA409338 cDNA ORF Clone, Mouse;Mel cDNA ORF Clone, Mouse
RAB8A Background Information
Full Name
RAB8A, member RAS oncogene family

RAB8A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB8A cDNA ORF Clone in Cloning Vector, Rat RG80645-U
RAB8A cDNA ORF Clone, Rat, untagged RG80645-UT
RAB8A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80645-ACGLN
RAB8A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80645-ACG
RAB8A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80645-ACR
RAB8A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80645-CF
RAB8A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80645-NF
RAB8A cDNA ORF Clone, Rat, C-His tag RG80645-CH
RAB8A cDNA ORF Clone, Rat, N-His tag RG80645-NH
RAB8A cDNA ORF Clone, Rat, C-HA tag RG80645-CY
RAB8A cDNA ORF Clone, Rat, N-HA tag RG80645-NY
RAB8A cDNA ORF Clone, Rat, C-Myc tag RG80645-CM
RAB8A cDNA ORF Clone, Rat, N-Myc tag RG80645-NM
RAB8A qPCR Primer Pairs, Rat RP300609

RAB8A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB8A cDNA ORF Clone in Cloning Vector, Mouse MG52797-G
RAB8A cDNA ORF Clone, Mouse, untagged MG52797-UT
RAB8A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52797-ACGLN
RAB8A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52797-ACG
RAB8A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52797-ANG
RAB8A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52797-ACR
RAB8A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52797-ANR
RAB8A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52797-CF
RAB8A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52797-NF
RAB8A cDNA ORF Clone, Mouse, C-His tag MG52797-CH
RAB8A cDNA ORF Clone, Mouse, N-His tag MG52797-NH
RAB8A cDNA ORF Clone, Mouse, C-HA tag MG52797-CY
RAB8A cDNA ORF Clone, Mouse, N-HA tag MG52797-NY
RAB8A cDNA ORF Clone, Mouse, N-Myc tag MG52797-NM

RAB8A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB8A cDNA ORF Clone in Cloning Vector, Human HG18356-U
RAB8A cDNA ORF Clone, Human, untagged HG18356-UT
RAB8A cDNA ORF Clone, Human, C-GFPSpark® tag HG18356-ACG
RAB8A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18356-ACGLN
RAB8A cDNA ORF Clone, Human, C-OFPSpark® tag HG18356-ACR
RAB8A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18356-CF
RAB8A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18356-NF
RAB8A cDNA ORF Clone, Human, C-His tag HG18356-CH
RAB8A cDNA ORF Clone, Human, N-His tag HG18356-NH
RAB8A cDNA ORF Clone, Human, C-HA tag HG18356-CY
RAB8A cDNA ORF Clone, Human, N-HA tag HG18356-NY
RAB8A cDNA ORF Clone, Human, C-Myc tag HG18356-CM
RAB8A cDNA ORF Clone, Human, N-Myc tag HG18356-NM
info info
添加购物车成功! 添加购物车失败!