RAB6A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52249-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAB6A Reagents
CRO Services
Product recommended

All RAB6A Reagents
RAB6A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
627 bp
Description
Full length Clone DNA of Mouse RAB6A, member RAS oncogene family with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB6A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
2610028L11Rik cDNA ORF Clone, Mouse;AA419671 cDNA ORF Clone, Mouse;Rab6 cDNA ORF Clone, Mouse
RAB6A Background Information
Full Name
RAB6A, member RAS oncogene family

RAB6A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB6A cDNA ORF Clone in Cloning Vector, Rat RG85406-U
RAB6A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85406-ACGLN

RAB6A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB6A cDNA ORF Clone in Cloning Vector, Mouse MG52249-U
RAB6A cDNA ORF Clone, Mouse, untagged MG52249-UT
RAB6A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52249-ACG
RAB6A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52249-ACGLN
RAB6A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52249-ANG
RAB6A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52249-ACR
RAB6A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52249-ANR
RAB6A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52249-NF
RAB6A cDNA ORF Clone, Mouse, C-His tag MG52249-CH
RAB6A cDNA ORF Clone, Mouse, N-His tag MG52249-NH
RAB6A cDNA ORF Clone, Mouse, C-HA tag MG52249-CY
RAB6A cDNA ORF Clone, Mouse, N-HA tag MG52249-NY
RAB6A cDNA ORF Clone, Mouse, C-Myc tag MG52249-CM
RAB6A cDNA ORF Clone, Mouse, N-Myc tag MG52249-NM
RAB6A qPCR Primer Pairs, Mouse MP202122

RAB6A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB6A cDNA ORF Clone in Cloning Vector, Human HG16015-U
RAB6A cDNA ORF Clone, Human, untagged HG16015-UT
RAB6A cDNA ORF Clone, Human, C-GFPSpark® tag HG16015-ACG
RAB6A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16015-ACGLN
RAB6A cDNA ORF Clone, Human, N-GFPSpark® tag HG16015-ANG
RAB6A cDNA ORF Clone, Human, C-OFPSpark® tag HG16015-ACR
RAB6A cDNA ORF Clone, Human, N-OFPSpark® tag HG16015-ANR
RAB6A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16015-CF
RAB6A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16015-NF
RAB6A cDNA ORF Clone, Human, C-His tag HG16015-CH
RAB6A cDNA ORF Clone, Human, N-His tag HG16015-NH
RAB6A cDNA ORF Clone, Human, C-HA tag HG16015-CY
RAB6A cDNA ORF Clone, Human, N-HA tag HG16015-NY
RAB6A cDNA ORF Clone, Human, C-Myc tag HG16015-CM
RAB6A cDNA ORF Clone, Human, N-Myc tag HG16015-NM
info info
添加购物车成功! 添加购物车失败!