RAB5C cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51796-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RAB5C Reagents
CRO Services
Product recommended

All RAB5C Reagents
RAB5C cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
651 bp
Description
Full length Clone DNA of Mouse RAB5C, member RAS oncogene family with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB5C cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AI326010 cDNA ORF Clone, Mouse;Rabl cDNA ORF Clone, Mouse
RAB5C Background Information
Full Name
RAB5C, member RAS oncogene family

RAB5C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB5C cDNA ORF Clone in Cloning Vector, Mouse MG51796-G
RAB5C cDNA ORF Clone, Mouse, untagged MG51796-UT
RAB5C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51796-ACG
RAB5C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51796-ACGLN
RAB5C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51796-ACR
RAB5C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51796-CF
RAB5C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51796-NF
RAB5C cDNA ORF Clone, Mouse, C-His tag MG51796-CH
RAB5C cDNA ORF Clone, Mouse, N-His tag MG51796-NH
RAB5C cDNA ORF Clone, Mouse, C-HA tag MG51796-CY
RAB5C cDNA ORF Clone, Mouse, N-HA tag MG51796-NY
RAB5C cDNA ORF Clone, Mouse, N-Myc tag MG51796-NM
RAB5C qPCR Primer Pairs, Mouse MP201669

RAB5C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB5C cDNA ORF Clone in Cloning Vector, Human HG15817-G
RAB5C cDNA ORF Clone, Human, untagged HG15817-UT
RAB5C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15817-ACGLN
RAB5C cDNA ORF Clone, Human, C-GFPSpark® tag HG15817-ACG
RAB5C cDNA ORF Clone, Human, C-OFPSpark® tag HG15817-ACR
RAB5C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15817-CF
RAB5C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15817-NF
RAB5C cDNA ORF Clone, Human, C-His tag HG15817-CH
RAB5C cDNA ORF Clone, Human, N-His tag HG15817-NH
RAB5C cDNA ORF Clone, Human, C-HA tag HG15817-CY
RAB5C cDNA ORF Clone, Human, N-HA tag HG15817-NY
RAB5C cDNA ORF Clone, Human, C-Myc tag HG15817-CM
RAB5C cDNA ORF Clone, Human, N-Myc tag HG15817-NM
RAB5C qPCR Primer Pairs, Human HP104408
info info
添加购物车成功! 添加购物车失败!